ID: 1176948073

View in Genome Browser
Species Human (GRCh38)
Location 21:15008369-15008391
Sequence TTCGCCCAACTCTAGAGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176948073_1176948075 2 Left 1176948073 21:15008369-15008391 CCAAACCTCTAGAGTTGGGCGAA 0: 1
1: 0
2: 2
3: 13
4: 152
Right 1176948075 21:15008394-15008416 ACCGTAGAAGAAGTATTAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 95
1176948073_1176948077 21 Left 1176948073 21:15008369-15008391 CCAAACCTCTAGAGTTGGGCGAA 0: 1
1: 0
2: 2
3: 13
4: 152
Right 1176948077 21:15008413-15008435 AAGGTACACAAATCATAAAGAGG 0: 1
1: 0
2: 1
3: 22
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176948073 Original CRISPR TTCGCCCAACTCTAGAGGTT TGG (reversed) Intronic
900733039 1:4275427-4275449 TTCGTGCAGCTCTAGAGGCTAGG - Intergenic
903677382 1:25072847-25072869 GTCCCCCAACTCCAGAGCTTTGG + Intergenic
905000466 1:34664172-34664194 TTCTCACAGCTCTAGAGGCTGGG - Intergenic
906103366 1:43277126-43277148 TTGGCCCAGCTAGAGAGGTTAGG + Intergenic
911764245 1:101655135-101655157 TTCTCACAGCTCCAGAGGTTGGG - Intergenic
911775181 1:101800931-101800953 TTCGCACAGTTCTGGAGGTTGGG + Intergenic
912165134 1:107034587-107034609 TTCTCCCAATTCTGGAGGCTTGG + Intergenic
915267514 1:154729440-154729462 CACGCCTAACTCTAGAGATTCGG + Intronic
915998562 1:160591000-160591022 TTCTCACAGTTCTAGAGGTTGGG + Intergenic
916156047 1:161849638-161849660 TTTACCCAACTCTCAAGGTTTGG + Intronic
919536945 1:198798709-198798731 TTCACACAACTCTAGAAGCTGGG - Intergenic
919687733 1:200499741-200499763 TTCTCACAGCTCTAGAGGCTGGG - Intergenic
921951299 1:220932867-220932889 TTCTCACAGCTCTAGAGGCTGGG + Intergenic
922164918 1:223107603-223107625 TTCCCCCAGCTCTAGGGGGTGGG - Intergenic
923823631 1:237475094-237475116 TTCTAACAACTCTATAGGTTAGG + Intronic
1064350407 10:14571024-14571046 TTCTCACAATTCTAGAGGCTGGG + Intronic
1064379221 10:14825412-14825434 TGGCCCCAACTTTAGAGGTTTGG + Intronic
1067214020 10:44285524-44285546 TTCTCCCATCCCTGGAGGTTGGG - Intergenic
1067221215 10:44345692-44345714 TTCTCACAGTTCTAGAGGTTGGG + Intergenic
1070984860 10:80679979-80680001 CTCGCCCCTCCCTAGAGGTTGGG - Intergenic
1071885103 10:89941133-89941155 TCCACCCAACTCCAGAGATTGGG - Intergenic
1072411374 10:95205329-95205351 TTCTCACAACTCTGGAGGCTGGG + Intronic
1073517715 10:104092333-104092355 TTCTCACAATTCTAGAGGTTGGG - Intergenic
1079315287 11:19402991-19403013 TGCGCCCAGCTCTAGAGTCTGGG - Intronic
1079991218 11:27248924-27248946 TTCTCCTCACTCTTGAGGTTTGG - Intergenic
1080104466 11:28497597-28497619 TTCTCACAATTCTAGAGGCTGGG + Intergenic
1081548644 11:44091917-44091939 TTCTCCCAGCTCTAGAGGCTAGG - Intergenic
1088009632 11:104984379-104984401 TTCTCACAATTCTAGAGGCTGGG - Intergenic
1090346032 11:126071555-126071577 TTAGCCTAAGTCTAGAGGCTGGG + Intergenic
1090876729 11:130796644-130796666 TTCTCACAGCTCTAGAGGCTGGG - Intergenic
1093104469 12:15069186-15069208 TTCTCCCAGTTCTAGAGGCTGGG + Intergenic
1096219855 12:49822226-49822248 TTCTCACAGCTCTAGAGGCTGGG - Intronic
1097042676 12:56165138-56165160 TTCCCCAAACTCGAGAGCTTTGG - Intronic
1098366995 12:69714104-69714126 TGTGCCCAACTCTGGAGGTTTGG + Intergenic
1099504400 12:83454882-83454904 TTCCCACAGCTCTAGAGGCTGGG - Intergenic
1099708138 12:86183618-86183640 TTCCCCCAGTTCTAGAGGCTGGG + Intronic
1100050576 12:90444134-90444156 GTCTCCCAACTCCAGAGGTTGGG + Intergenic
1100150004 12:91725364-91725386 CTCTCCCAACCCCAGAGGTTGGG - Intergenic
1106930658 13:34660602-34660624 TTCTCACAATTCTGGAGGTTGGG + Intergenic
1107058147 13:36129078-36129100 TTCTCCCAACACTAGGAGTTTGG + Intronic
1107076433 13:36325942-36325964 TTCTCACAATTCTAGAGGCTGGG + Intronic
1108161477 13:47644791-47644813 ATCTCACAATTCTAGAGGTTGGG - Intergenic
1108977562 13:56467722-56467744 TTAGCCTAACTGTGGAGGTTAGG - Intergenic
1109762771 13:66851852-66851874 TTCTCACAGCTCTAGAGGCTGGG + Intronic
1110931404 13:81223089-81223111 TTCTCACAGTTCTAGAGGTTGGG - Intergenic
1111952276 13:94718212-94718234 TTCTCCCAACCCTAGATGTCCGG + Intergenic
1112034415 13:95484079-95484101 TTCTCACAATTCTAGAGGCTGGG - Intronic
1113918350 13:113888302-113888324 TTCTCCCCTCCCTAGAGGTTGGG - Intergenic
1115194596 14:30782727-30782749 TTCTCCCAATTCTGGAGGCTGGG + Intergenic
1116095892 14:40367041-40367063 TTCTCACAGTTCTAGAGGTTGGG + Intergenic
1118493548 14:66285742-66285764 TTCTCACAATTCTAGAGGCTGGG + Intergenic
1120327005 14:83042868-83042890 TTCTCACAATTCTAGAGGCTAGG + Intergenic
1122397059 14:101441291-101441313 TGAGCCCACCTCTAGAGGCTGGG + Intergenic
1123129847 14:105976136-105976158 TTCTCGCAGCTCTAGAGGCTGGG - Intergenic
1123580041 15:21706662-21706684 TTCTCCCAGCTCTAGAGGCTGGG - Intergenic
1123616689 15:22149284-22149306 TTCTCCCAGCTCTAGAGGCTGGG - Intergenic
1125007387 15:34833093-34833115 TTCTCACAATTCTGGAGGTTGGG + Intergenic
1130571056 15:85044204-85044226 TTTGCCCAACACTACGGGTTTGG + Intronic
1131526302 15:93155412-93155434 TTTTCACAACTCTAGAGGCTGGG - Intergenic
1131616081 15:94018682-94018704 TTCCCCCCACTCTGGAGGTGGGG + Intergenic
1202988911 15_KI270727v1_random:440907-440929 TTCTCCCAGCTCTAGAGGCTGGG - Intergenic
1133830213 16:9316120-9316142 TTCTCACAGCTCTAGAGGCTGGG + Intergenic
1134641448 16:15832311-15832333 TTTTCCCAACCCCAGAGGTTTGG + Intronic
1138216175 16:55207241-55207263 TTCCCCCAGCTTTAGAAGTTGGG - Intergenic
1138695715 16:58811358-58811380 TTCTCACAGCTCTGGAGGTTGGG + Intergenic
1140670758 16:77276638-77276660 TTGGCCCAGCTCAAGAAGTTAGG - Intronic
1144026395 17:11279703-11279725 TTCTCCCAACTCCCGTGGTTGGG + Intronic
1145766638 17:27462408-27462430 GTGGCTCAACTCTAGATGTTTGG + Intronic
1148490103 17:48017875-48017897 TTCCTCCAACTCTGGAGATTTGG - Intergenic
1151080702 17:71325345-71325367 CTCTCCCCTCTCTAGAGGTTGGG + Intergenic
1153056510 18:950894-950916 TTAGCCCAAGTCCAGAAGTTTGG + Intergenic
1155343960 18:24840204-24840226 TTCCCACAGCTCTAGAGGTTAGG - Intergenic
1155475434 18:26232564-26232586 GTCGCCCAACTCCAGAGGTTGGG + Intronic
1157888787 18:51394611-51394633 TTCTCACAGCTCTAGAGGCTGGG - Intergenic
1163083103 19:14957588-14957610 TTCGCACAGCTCTGGAGGGTGGG - Intronic
929337533 2:40768122-40768144 TGCTCTCAACTCTAGAGGTCAGG - Intergenic
930305640 2:49671153-49671175 TTCTCGTAACTCTAGAGGATGGG - Intergenic
930867479 2:56136138-56136160 TTCTCACAGGTCTAGAGGTTGGG + Intergenic
932054319 2:68429506-68429528 TTCTCCCCTCTCCAGAGGTTGGG - Intergenic
932675449 2:73776604-73776626 ATCACCAAAGTCTAGAGGTTAGG + Intronic
936372780 2:111917058-111917080 TTCCCCCTACTCTAGTGTTTGGG - Intronic
937468671 2:122156626-122156648 TTCCCCCAGCTCTAAAGTTTGGG + Intergenic
937575194 2:123411327-123411349 TTCCCCCAAATTTAGAGGCTTGG - Intergenic
938810121 2:134845218-134845240 TTCTCCCCACTGCAGAGGTTTGG + Exonic
940537686 2:154967252-154967274 TTCTCACAATTCTAGAGGCTGGG - Intergenic
943487354 2:188502822-188502844 TTCTCACAACTCTGGAGGCTAGG + Intronic
943500192 2:188679090-188679112 CTTGCCCAACTCTAGAGGCCAGG + Intergenic
943546071 2:189280116-189280138 TTCTCACAATTCTGGAGGTTGGG - Intergenic
944225051 2:197341284-197341306 TTCTCACAATTCTGGAGGTTGGG - Intergenic
1170496113 20:16927063-16927085 TTCTCACAACTCTGGAGGCTAGG - Intergenic
1171238193 20:23544971-23544993 TTTTCACAGCTCTAGAGGTTGGG - Intergenic
1171368923 20:24647886-24647908 TTCTCACAATTCTAGAGGCTGGG + Intronic
1173523798 20:43717187-43717209 TGCGGCCAACTCTAGAGGGATGG + Intergenic
1176408275 21:6433712-6433734 TTCCCCCACCTCGAGAGCTTTGG + Intergenic
1176948073 21:15008369-15008391 TTCGCCCAACTCTAGAGGTTTGG - Intronic
1177781271 21:25624755-25624777 TTCTCACAGTTCTAGAGGTTGGG - Intergenic
1178377683 21:32081204-32081226 TTCTCCCAATTCTGGAGGCTGGG + Intergenic
1179683769 21:43042038-43042060 TTCCCCCACCTCGAGAGCTTTGG + Intergenic
1184019133 22:41808866-41808888 TTCTTCCAGCTCAAGAGGTTTGG + Exonic
949604363 3:5637136-5637158 TTCTCACAGTTCTAGAGGTTGGG + Intergenic
952831970 3:37572493-37572515 TTATCCCAACTTTAGAGGTGAGG - Intronic
956453176 3:69394112-69394134 TTCTCACAGCTCTAGAGGCTGGG + Intronic
956774527 3:72553939-72553961 TTCTCACAATTCTAGAGGTCAGG + Intergenic
959311668 3:104745671-104745693 TTCTCACAGCTCTAGAGGTTGGG - Intergenic
960619382 3:119624120-119624142 TTCCCACAGCTCTAGAGGCTGGG + Intronic
962099092 3:132323044-132323066 TGCTCACAATTCTAGAGGTTAGG - Intronic
963261592 3:143197253-143197275 TTCTCCCAGCTCTGGAGGATGGG - Intergenic
964155069 3:153575475-153575497 TTCTCACACCTCTAGAGGCTGGG + Intergenic
964402281 3:156311759-156311781 TTAGCCCCACACCAGAGGTTTGG - Intronic
964703383 3:159593261-159593283 TTAGCCCAACTCTGGAGTTGAGG + Intronic
964881753 3:161431155-161431177 TTCGCCCAGTTCTGCAGGTTAGG + Intergenic
965428182 3:168553536-168553558 TTCTCACAACTCTGGAGGCTGGG + Intergenic
969642520 4:8407505-8407527 TTCTCCCAACTCTGGAGGCCGGG - Intronic
970047196 4:11868144-11868166 TTCTCCCTAGCCTAGAGGTTGGG + Intergenic
972142297 4:35975990-35976012 TTCTCACAGTTCTAGAGGTTGGG + Intronic
975570750 4:75815366-75815388 TTAGCCCAATTCTGGAGGTTGGG - Intergenic
977448533 4:97163305-97163327 TTCTCACAATTCTAGAGGCTGGG - Intergenic
978083899 4:104626200-104626222 CTCCCCCTTCTCTAGAGGTTGGG - Intergenic
978331344 4:107615969-107615991 TTCTCACAGTTCTAGAGGTTGGG - Intronic
980164560 4:129209664-129209686 TTCCTCCAACTCTAGATGTTTGG - Intergenic
980729511 4:136809106-136809128 TTCTCATAACTCTGGAGGTTGGG + Intergenic
980972134 4:139576687-139576709 TTCGCACAGTTCTGGAGGTTGGG + Intronic
983049855 4:163033431-163033453 TTCTCACAGTTCTAGAGGTTGGG - Intergenic
983512652 4:168625962-168625984 TTAGCCCAACAGTAGATGTTTGG - Intronic
986029042 5:3878440-3878462 TTCTCACATTTCTAGAGGTTGGG + Intergenic
986406077 5:7426347-7426369 TTCTCTCAATTCTGGAGGTTAGG + Intronic
987824330 5:23008799-23008821 TTCTCACAGTTCTAGAGGTTGGG - Intergenic
989754974 5:44941175-44941197 TTCTCACAATTCTAGAGGCTAGG + Intergenic
991996438 5:72391610-72391632 TTCTCACAATTCTAGAGGCTGGG - Intergenic
992881737 5:81117294-81117316 TTCTCACAATTCTGGAGGTTGGG + Intronic
993434871 5:87880310-87880332 TTCTCACAACTCTGGAGGTTGGG + Intergenic
993748010 5:91625780-91625802 TTCTCACAATTCTAGAGGCTGGG - Intergenic
999133080 5:149299417-149299439 TCCGCCCAACTCTAGGTGGTGGG + Intronic
1000524839 5:162344632-162344654 TTCTCACAATTCTAGAGGCTAGG + Intergenic
1002381832 5:178836203-178836225 TTCTCACAGTTCTAGAGGTTGGG + Intergenic
1002614590 5:180442962-180442984 TTCTCACAACTCTAGAGGTTGGG - Intergenic
1003644116 6:7900675-7900697 TTCGCCTAGCTCTAGAGACTGGG + Intronic
1010156791 6:72803576-72803598 TTCTCAGAACTCTGGAGGTTTGG + Intronic
1011753713 6:90478273-90478295 TTCTCCCAGTTCTGGAGGTTAGG - Intergenic
1012786040 6:103627129-103627151 TTCTCACAATTCTAGAGGCTGGG - Intergenic
1020563681 7:9768652-9768674 TTCTCACAATTCTAGAGGCTGGG - Intergenic
1021891136 7:25187530-25187552 TTCTCACAGTTCTAGAGGTTGGG + Intergenic
1022843084 7:34183059-34183081 TTCTCACAAGTCTAGAGGCTTGG - Intergenic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1024184995 7:46940596-46940618 CTCCCTCAGCTCTAGAGGTTGGG + Intergenic
1025815533 7:64907687-64907709 TTCCACAAACTCTAGAGATTTGG + Intronic
1031439191 7:121772334-121772356 TTAACCCTACTCCAGAGGTTTGG - Intergenic
1031500011 7:122502593-122502615 TTTGACAAAATCTAGAGGTTAGG + Intronic
1031941313 7:127792560-127792582 TTCCCCCAACCTTAGAGGGTAGG - Intronic
1035444146 7:158928411-158928433 TTCCCTCATCTCAAGAGGTTAGG - Intronic
1036161780 8:6395749-6395771 TTCTCACAACTGTAGAGGCTAGG + Intergenic
1037456914 8:19072934-19072956 TTGGCCCAACTATAAAGGATGGG + Intronic
1041117376 8:54553310-54553332 TTCTCACAGCTCCAGAGGTTGGG + Intergenic
1041156617 8:54993682-54993704 TTCTCACAGCTCTAGAGGCTAGG + Intergenic
1041403894 8:57474779-57474801 TTCTCACGATTCTAGAGGTTGGG + Intergenic
1047506891 8:125487210-125487232 CTCTCCCCACTCTAGAGATTAGG - Intergenic
1050389166 9:5120053-5120075 TTCTCACACTTCTAGAGGTTAGG + Intronic
1052473090 9:28924620-28924642 TTGTCCCAACTATAGATGTTTGG + Intergenic
1054705891 9:68461715-68461737 TTCCCACAGTTCTAGAGGTTAGG - Intronic
1058827589 9:108788646-108788668 TTCTCACAGCTCTGGAGGTTGGG + Intergenic
1059882859 9:118711080-118711102 TTCTCACAATTCTAGAGGCTTGG + Intergenic
1060942842 9:127553250-127553272 TTCTCACAGCTCTGGAGGTTTGG - Intronic
1186590724 X:10927583-10927605 TTCTCACAGCTCTAGAGGTTGGG + Intergenic
1186745507 X:12563976-12563998 TTCTCCCAACTCTGGGGGCTAGG + Intronic
1187623007 X:21079496-21079518 TTACCCCAAATCTAGAGCTTGGG + Intergenic
1188235967 X:27731447-27731469 TTCTCACAGATCTAGAGGTTAGG + Intronic
1195875088 X:109532293-109532315 TTTGCAGAACTCTAGAAGTTAGG + Intergenic
1196082905 X:111651667-111651689 TCCGCCCAAATCTAGAAGATGGG + Intergenic