ID: 1176948458

View in Genome Browser
Species Human (GRCh38)
Location 21:15013597-15013619
Sequence GACCTTATGCTGCTTATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176948458_1176948460 9 Left 1176948458 21:15013597-15013619 CCAGAAATAAGCAGCATAAGGTC 0: 1
1: 0
2: 1
3: 16
4: 158
Right 1176948460 21:15013629-15013651 AAGACATGACAAATTCATTTAGG 0: 1
1: 0
2: 2
3: 36
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176948458 Original CRISPR GACCTTATGCTGCTTATTTC TGG (reversed) Intronic
907020202 1:51059633-51059655 GAACTTATGGTGCTTTTTCCAGG + Intergenic
908906358 1:69016217-69016239 GATCTTATGCTGCTTTTTGTTGG + Intergenic
910259867 1:85284321-85284343 GAACTTATGGTGCTATTTTCAGG + Intergenic
911025865 1:93435047-93435069 GAACTTATGGTGCTTTTTTCAGG - Intergenic
911654852 1:100431960-100431982 GATTTTATTCTGCTGATTTCAGG + Intronic
912013744 1:105005566-105005588 GAACTTATGGTGCTTTTTCCAGG - Intergenic
915828780 1:159105830-159105852 GAACTTACGGTGCTTTTTTCAGG - Intronic
918979818 1:191541798-191541820 GACCTTATAATGCTGACTTCAGG + Intergenic
919249153 1:195030525-195030547 GAACTTAGGGTGCTTTTTTCAGG - Intergenic
920368253 1:205459994-205460016 GACCTGGTGCTGCTCTTTTCTGG + Intergenic
920597019 1:207282220-207282242 GACCATATCCTGCTTTTCTCAGG + Intergenic
921766940 1:218983431-218983453 GAACTTATGGTGCTTTTTCCGGG - Intergenic
922055630 1:222040048-222040070 GACCATCTGCTGCTGATGTCAGG + Intergenic
923842389 1:237687306-237687328 GACATCATGTTGCTTTTTTCCGG + Intronic
1063940135 10:11120035-11120057 GACCAAATTCTGCTTATGTCAGG - Intronic
1065201457 10:23316912-23316934 GAACTTATGGTGCTTTTTTCAGG - Exonic
1066267315 10:33788814-33788836 GAGCTTATGCTTATTTTTTCTGG - Intergenic
1066978490 10:42390525-42390547 GCCCCTATACTGCTTATTTCAGG - Intergenic
1068287658 10:54961511-54961533 GAACTTATGCTGATTTTTCCAGG + Intronic
1068938443 10:62657981-62658003 GAACTTATGGTGCTTTTTCCAGG + Intronic
1069212521 10:65779520-65779542 GAACTTATGGTGCTTTTTCCAGG + Intergenic
1074293932 10:112165182-112165204 GACCTTCTGCTCCTTATCCCTGG + Intronic
1075312891 10:121429725-121429747 CACCTTATGCAGCTTTTTTCAGG + Intergenic
1077528746 11:3085077-3085099 GACCTTATGGTGCTTGTTGCTGG - Intergenic
1079996975 11:27305154-27305176 GACCTTATGGTGCTTTCTCCAGG + Intergenic
1085922851 11:80979785-80979807 TACTTTATGCTTCTTATTGCAGG - Intergenic
1086508301 11:87528647-87528669 GAACTTATGGTGCTTTTTTCAGG - Intergenic
1092272049 12:7031168-7031190 GAACTTATGGTGCTTTTTCCAGG - Intronic
1092388860 12:8057436-8057458 GTGCTTATGCTGCTCTTTTCTGG - Intergenic
1093764973 12:22952569-22952591 GAACTTATGGTGCTTTTTCCAGG - Intergenic
1096606694 12:52771804-52771826 GAGCTTATGCTGCTTCTCTCCGG + Intronic
1097855044 12:64452718-64452740 CATCTTATGCTTCTAATTTCCGG - Intronic
1099049759 12:77768209-77768231 GAACTTATGGTGCTTTTTCCAGG - Intergenic
1099322018 12:81162526-81162548 GAACTTATGGTGCTTTTTCCAGG - Intronic
1100287306 12:93179587-93179609 GGCCTTATGCTGATTCTTTTTGG - Intergenic
1106224376 13:27774030-27774052 GACCTCATGCTGCTGATGCCAGG + Intergenic
1106979119 13:35256409-35256431 GAACTTATGGTGATTTTTTCAGG - Intronic
1109004439 13:56853777-56853799 GATCTTTTGTTCCTTATTTCAGG + Intergenic
1109888310 13:68573196-68573218 GACAATATGCTGAGTATTTCTGG + Intergenic
1110342926 13:74413935-74413957 GAACTTATGGTGCTTTTTCCAGG + Intergenic
1111119257 13:83824083-83824105 GAACTTATGGTGCTTTTTCCTGG + Intergenic
1111309784 13:86469822-86469844 AAAATTATGCTTCTTATTTCTGG - Intergenic
1114780142 14:25530086-25530108 ATCCTGATGCTGCTTATTACTGG - Intergenic
1116181877 14:41544808-41544830 GAACAGGTGCTGCTTATTTCAGG - Intergenic
1116448544 14:45039314-45039336 GAACTTATGGTGCTTTTTCCAGG - Intronic
1116617272 14:47154916-47154938 GAACTTATGGTGCTTTTTCCAGG + Intronic
1116789987 14:49329882-49329904 GAACTTATGGTGCTTTCTTCAGG - Intergenic
1120592319 14:86390603-86390625 GAACTTATGGTGCTTTTTCCAGG + Intergenic
1121697560 14:95926210-95926232 GACCTGATTCTGCTAGTTTCTGG - Intergenic
1124820850 15:33044376-33044398 GAACTTATGATGCTTTTTCCAGG + Intronic
1126979621 15:54227269-54227291 GAACTTATGGTGCTTTTTCCAGG - Intronic
1127328891 15:57919963-57919985 GTCCTTATGGAGCTTATTTCTGG + Intergenic
1133357651 16:5148352-5148374 GAGCTTTTGCTTCTTATTCCGGG + Intergenic
1134862964 16:17577345-17577367 GAGATTGTGCTGTTTATTTCAGG - Intergenic
1136864607 16:33736040-33736062 GACCTTATTCTGTGTATTCCAGG + Intergenic
1138407043 16:56804418-56804440 GACATTATGCTGATTGTCTCTGG + Intronic
1139015496 16:62684414-62684436 GAACTTATGGTGCTTTTTCCAGG + Intergenic
1139150973 16:64381456-64381478 GAACTTATGGTGCTTTTTCCAGG + Intergenic
1203126102 16_KI270728v1_random:1584176-1584198 GACCTTATTCTGTGTATTCCAGG + Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1150201515 17:63362322-63362344 GAACTTATGGTGCTTTTTCCAGG - Intronic
1150868611 17:68880088-68880110 GAACTTATGATGCTTTTTCCAGG + Intronic
1153427978 18:4987530-4987552 GAACTTATGGTGCTTTTTCCAGG - Intergenic
1153895120 18:9551722-9551744 GAACTAATGCTCCTTATTCCAGG + Intronic
1154935326 18:21049140-21049162 GATCTGATTCTGCTTTTTTCTGG - Exonic
1155127684 18:22895577-22895599 GCCCTTCTGCTGCTTTTTCCAGG + Intronic
1156112877 18:33748553-33748575 GAACTTATGCTGCTTTCCTCGGG - Exonic
1156599432 18:38587301-38587323 GGCCAAATGCTACTTATTTCCGG + Intergenic
1156850357 18:41718784-41718806 GACCTTGTGCTGCATTTTACTGG - Intergenic
1158031113 18:52966273-52966295 CTCCTTATGCTGCTCATTTTTGG - Intronic
1160154886 18:76425722-76425744 GACCTTGTCCTGCATTTTTCAGG + Intronic
1167410511 19:49341238-49341260 CACCTCATGCTTCTTATTTGGGG - Exonic
928831784 2:35494703-35494725 TGCATTATACTGCTTATTTCAGG - Intergenic
929047143 2:37801098-37801120 GATATTATTCAGCTTATTTCAGG + Intergenic
930612021 2:53554265-53554287 GAACTTGTGGTGCTTTTTTCTGG + Intronic
930729025 2:54709717-54709739 GAACTTGTGGTGCTTTTTTCGGG + Intergenic
932045063 2:68340052-68340074 GACATTGTACTGCTTATTTGAGG + Intergenic
933042601 2:77487743-77487765 GAACTTATGGTGCTTTTTCCAGG + Intronic
934633141 2:95952861-95952883 GACCTTATTCTGTGTATTCCAGG + Intronic
934800360 2:97150413-97150435 GACCTTATTCTGTGTATTCCAGG - Intronic
936144988 2:109974886-109974908 GACTTCATGCTGCTAATGTCAGG + Intergenic
936181674 2:110272849-110272871 GACTTCATGCTGCTAATGTCAGG + Intergenic
936199698 2:110396581-110396603 GACTTCATGCTGCTAATGTCAGG - Intergenic
936230892 2:110698831-110698853 GACTTCATGCTGCTAATGTCAGG - Intergenic
937550941 2:123090439-123090461 ATCCTTGTGCTGCTTGTTTCGGG + Intergenic
940608886 2:155965086-155965108 GACCTTATGCATGTTATTTTTGG - Intergenic
940771360 2:157842307-157842329 TACTTTATGCAGTTTATTTCTGG - Intronic
940956952 2:159738733-159738755 GAACTTATGGTGCTTATCCCAGG - Intronic
942585057 2:177466373-177466395 GAACTTATGATGCTTTTTCCGGG - Intronic
943960220 2:194254489-194254511 GAACTTATGCTGCTTTTTCCAGG + Intergenic
943965570 2:194327937-194327959 GAACTTATGGTGCTTTTTCCCGG + Intergenic
944146751 2:196514553-196514575 GAACTTATGGTGCTTTTTCCCGG + Intronic
945527014 2:210900783-210900805 GAACTCTAGCTGCTTATTTCTGG + Intergenic
1170221558 20:13947163-13947185 GAACTTATGGTGCTTTTTTTAGG + Intronic
1170527223 20:17251139-17251161 GACCTTTTGTTTCTTATTGCAGG - Intronic
1174590439 20:51640668-51640690 GACCTTAAGCTGAGTATGTCTGG - Intronic
1176408408 21:6434322-6434344 GAACTTATGGTGCCTTTTTCGGG + Intergenic
1176948458 21:15013597-15013619 GACCTTATGCTGCTTATTTCTGG - Intronic
1179683901 21:43042648-43042670 GAACTTATGGTGCCTTTTTCGGG + Intergenic
1181428442 22:22859407-22859429 GACCTCATGCTCCTTAACTCAGG - Intronic
1183458900 22:37937724-37937746 TAACTGCTGCTGCTTATTTCAGG + Exonic
949373715 3:3363830-3363852 GACCCTGTCCTGCTTATCTCGGG - Intergenic
951055203 3:18139429-18139451 CACCATATGCTGCCTATTACAGG + Intronic
952102550 3:30031631-30031653 GACCCAAGGCTGCTTATTACAGG + Intergenic
957417892 3:79929605-79929627 GAGCTTATGGTGCTTTTTCCAGG + Intergenic
957636354 3:82790770-82790792 GAACTTATGATGCTTTTTCCCGG + Intergenic
959142917 3:102507387-102507409 GACCTTAATCTCCTTATTTTTGG - Intergenic
959252543 3:103966245-103966267 GAACTTATGGTGCTTTTTTAAGG + Intergenic
959484284 3:106908985-106909007 GAACTTATGGTGCTTTTTCCTGG + Intergenic
960003707 3:112760369-112760391 GACCTTCTGCTTCTGAGTTCTGG - Intronic
961311409 3:126004239-126004261 GAACTTATGGTGCTTTTTCCAGG + Intergenic
964927833 3:161978923-161978945 GAACTTATGATGCTTTTTCCAGG - Intergenic
967039600 3:185678459-185678481 TTCCTTGTGCTGCTGATTTCTGG + Intronic
970467442 4:16340087-16340109 GACCACATTGTGCTTATTTCAGG - Intergenic
971270966 4:25144865-25144887 TAACTTATCCTTCTTATTTCAGG - Exonic
972788184 4:42346523-42346545 GAACTTATGGTGCTTTTTCCAGG + Intergenic
973534520 4:51867726-51867748 GAACTTATGGTGCTTTTTCCAGG - Intronic
975857738 4:78642341-78642363 CACATTTTGCTGCTTATTTTTGG - Intergenic
979823166 4:125199675-125199697 GACCTTATGCTGGTAGATTCAGG + Intergenic
982169802 4:152649807-152649829 GACCTGAACCTGCATATTTCTGG - Intronic
982181342 4:152751263-152751285 GAACTTATGGTGCTTTTTCCAGG + Intronic
982498097 4:156117161-156117183 GAATTTAAGCTGCTTATTTATGG + Intergenic
985729125 5:1537230-1537252 GACCACATCCTTCTTATTTCAGG - Intergenic
985787496 5:1905534-1905556 GACATTGTGCTTTTTATTTCTGG - Intergenic
985916151 5:2920403-2920425 GAACTTATGGTGCTTTTTCCAGG + Intergenic
986183567 5:5416627-5416649 GAACTCATGCTGCTTATATGTGG + Intergenic
991218151 5:64180591-64180613 GACCATATGCTTCTTAATTAAGG - Intronic
991365773 5:65866486-65866508 GACAATATTCTGCCTATTTCAGG - Intronic
992548324 5:77837264-77837286 GACCTCATGATGCTTATATTTGG - Intronic
994891315 5:105639808-105639830 GAGCTTATGGTGCTTTTTCCAGG + Intergenic
995246531 5:109941363-109941385 GAAGTGATGCTGCTCATTTCTGG + Intergenic
995927019 5:117386484-117386506 GAACTTATGGTGCTTTTTCCAGG + Intergenic
1001834608 5:174821168-174821190 GGCATTATTCTGCTTATTGCAGG - Intergenic
1002880497 6:1246552-1246574 TACCTTAAGCTGCTGAGTTCGGG + Intergenic
1003124017 6:3340896-3340918 AAGCTTATGCTCCTTCTTTCAGG + Intronic
1003755604 6:9116213-9116235 GGCCTTCTGCTGCTAATTACTGG + Intergenic
1009588635 6:65638038-65638060 GAACTTACGGTGCTTTTTTCGGG + Intronic
1011462129 6:87615393-87615415 TGCTTTATGCTGCTTATTTAAGG + Intronic
1012160787 6:95882841-95882863 CACGTTATACTGCTTATTTTAGG + Intergenic
1012639047 6:101586137-101586159 GACCTATTGCTTCTTATTCCTGG - Intronic
1014227150 6:118861744-118861766 GAACTTATGGTGCTTTTTCCAGG - Intronic
1014892335 6:126857993-126858015 GACTTTATCCTGTTTCTTTCAGG - Intergenic
1015096212 6:129417488-129417510 GAACTTATGGTGCTTTTTTTGGG - Intronic
1015425262 6:133057822-133057844 GACCTTATGTTCCTTATGTTTGG + Intergenic
1016758853 6:147715968-147715990 GAACTTATGGTGCTTTTTCCAGG - Intronic
1017821095 6:158049542-158049564 GACCCTAAGCTGCTTCTTTTAGG - Intronic
1020832551 7:13110070-13110092 GAACTTATGGTGTTTTTTTCTGG - Intergenic
1022391893 7:29950574-29950596 GAACTTATGGTGCTTTTTCCAGG + Intronic
1028053092 7:86208734-86208756 GAACTTATGGTGCTTTTTCCAGG - Intergenic
1030981100 7:116186272-116186294 GAACTTATGGTGCTTTTTGCAGG - Intergenic
1034101801 7:148457194-148457216 GAACTTATGGTGCTTTTTTCAGG - Intergenic
1038121454 8:24621152-24621174 GACATTATTCAGCTTATTGCAGG - Intergenic
1039620319 8:38991378-38991400 GACCTTATTTTGCTAATTACTGG - Exonic
1043695191 8:83208474-83208496 GAACGTATGGTGCTTTTTTCAGG + Intergenic
1045089505 8:98726559-98726581 TACTTTTTGCTCCTTATTTCGGG - Intronic
1045327090 8:101125645-101125667 CAGCTGATGCTGCTTATTTCGGG + Intergenic
1045873375 8:106950403-106950425 GAACTTATGTTGCTTTTTTCAGG + Intergenic
1046187013 8:110734676-110734698 GAATTTATGGTGCTTTTTTCTGG - Intergenic
1048604881 8:135957116-135957138 GATCTGATGCTTCTCATTTCTGG + Intergenic
1049140499 8:140949889-140949911 GAACTTATGGTGCTTTTTCCGGG + Intronic
1049880851 8:145061714-145061736 GACCTTTTGCTGCATAAATCAGG - Intergenic
1050875147 9:10624376-10624398 GCACCAATGCTGCTTATTTCTGG - Intergenic
1052691451 9:31821033-31821055 GAACTTATGGTGCTTTTTTCAGG + Intergenic
1055536429 9:77250669-77250691 GCCCCTAGGCTGCTTACTTCTGG - Intronic
1056721036 9:89072252-89072274 GACCTTGAGCTGCTTATGACAGG + Intronic
1057085743 9:92208238-92208260 GACCTTATTTTTCTTCTTTCTGG + Intergenic
1060037155 9:120265297-120265319 GATCAAATGCTGCTTCTTTCAGG + Intergenic
1185950335 X:4425360-4425382 GACCCTTTACTGCTCATTTCTGG + Intergenic
1186612994 X:11156665-11156687 GACCATATGTTGCCTGTTTCTGG - Intronic
1189584349 X:42442795-42442817 TACCTTTGGCTGTTTATTTCTGG + Intergenic
1190802728 X:53806959-53806981 TTCCTTCTGCTGCTGATTTCTGG - Intergenic
1194513493 X:94822799-94822821 GACCTTATGCTGATTGGATCAGG - Intergenic
1197694157 X:129533117-129533139 GAGCTTATGCTGCTTATGTCTGG + Intergenic
1197821942 X:130550362-130550384 GACCTTGTGCTTCTCATTTCTGG - Intergenic
1198739750 X:139829141-139829163 GACATTCTGCTGCTTCTTTCAGG - Intronic
1201331931 Y:12833321-12833343 AACTTTATTCTGCTTATTTCTGG - Intronic