ID: 1176949722

View in Genome Browser
Species Human (GRCh38)
Location 21:15030726-15030748
Sequence TAGGTGGTAAGGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1088
Summary {0: 1, 1: 0, 2: 5, 3: 76, 4: 1006}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176949722 Original CRISPR TAGGTGGTAAGGAGGGAAGA AGG Intronic
900017396 1:162205-162227 GAGGAGGGAAGGAGGGAAAAAGG + Intergenic
900047655 1:520801-520823 GAGGAGGGAAGGAGGGAAAAAGG + Intergenic
900069869 1:762669-762691 AAGGAGGGAAGGAGGGAAAAAGG + Intergenic
900081175 1:858720-858742 CCGGTGGGAAGGAAGGAAGAGGG + Intergenic
901419753 1:9143004-9143026 CAGGAGGGAGGGAGGGAAGAAGG - Intergenic
901429121 1:9201753-9201775 GAGGAGGGAAGGAGGGAAGGAGG - Intergenic
901519079 1:9768958-9768980 AAAGGGGGAAGGAGGGAAGAAGG + Intronic
901895793 1:12310864-12310886 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
901895796 1:12310872-12310894 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
901895799 1:12310880-12310902 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
901895802 1:12310888-12310910 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
902304462 1:15525527-15525549 AGGGTGGGAGGGAGGGAAGAGGG - Intronic
902369598 1:15997480-15997502 GAGCTGGGAAGGAGGGAAGCAGG - Intergenic
902402578 1:16166262-16166284 AAGGTGGGAAGGAAGGAAGAAGG - Intergenic
902446757 1:16471287-16471309 CAGGGGTTAAGGAGGGAAGGAGG - Intergenic
902665632 1:17935753-17935775 AAGGTGGGAGGGAGGGAAGAAGG - Intergenic
902688922 1:18097423-18097445 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
902793908 1:18787926-18787948 AAGGAGGGAAGGAGGGAAAAAGG + Intergenic
902951950 1:19891596-19891618 TTGGAGGTGAGGAGGGGAGAGGG + Intronic
903181861 1:21608799-21608821 TAGGTTGGAAGGTGAGAAGAGGG + Intronic
903502834 1:23811101-23811123 TGGGTTGTAAGGTGGGGAGATGG + Intronic
903677638 1:25074447-25074469 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
903819558 1:26091585-26091607 TCAGTGGTAAGCAGGGAGGAAGG + Intergenic
904064652 1:27739896-27739918 TGGGTTTTAAGGAGAGAAGATGG + Intronic
904752760 1:32751179-32751201 TAGGTGGTATGGAAGGCATATGG - Intronic
904927835 1:34062535-34062557 AAGGTGGTGAAGAGGGCAGAGGG + Intronic
905303211 1:36999496-36999518 TGGGTGGTGAGTAGGGGAGATGG - Intronic
905721945 1:40211368-40211390 TAGGTGGTAGAGTGGAAAGAAGG - Intronic
905812985 1:40926575-40926597 GAGGTTTTAAGGAGGGCAGAGGG + Intergenic
905943921 1:41885799-41885821 TAGGAAGGAAGGAGGGAAGAAGG - Intronic
906257840 1:44364293-44364315 GAGGTGGGAAGGTGGGAAGGTGG - Intergenic
906558917 1:46739566-46739588 AAGGAGGGAAGGAGGGAAGAAGG - Intergenic
906566896 1:46807298-46807320 TAGCTGATAAGGAGGGAAGTGGG + Intronic
906580238 1:46930012-46930034 CAGGTGGGAAGAAGGGAAGGTGG + Exonic
906603487 1:47148878-47148900 CAGGTGGGAAGAAGGGAAGGTGG - Exonic
906764770 1:48418750-48418772 AAGGAGGGAAGGAAGGAAGAAGG + Intronic
906764785 1:48418798-48418820 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
906800825 1:48735520-48735542 AAGGAAGTAAGGAAGGAAGAAGG + Intronic
906927043 1:50128830-50128852 TAGTGGGTAAAGAAGGAAGATGG + Intronic
907038793 1:51239281-51239303 TAGGTGATGATGAGGGATGAGGG + Intronic
907337889 1:53712389-53712411 TAGATGGTGAGCAGGGAGGAAGG - Intronic
907589008 1:55647745-55647767 TGGGAGGTGAGGAGGGGAGAAGG + Intergenic
907652168 1:56305615-56305637 GGGGTGGTAATGAGGGAAGTGGG - Intergenic
908789753 1:67769965-67769987 TGGGAGGGAAGGAGGGGAGATGG + Intronic
908806207 1:67936075-67936097 TAGGAGGTAAAGAGGGATCATGG + Intergenic
909379655 1:74984012-74984034 GAGGTAGTAGAGAGGGAAGATGG - Intergenic
909472882 1:76049317-76049339 GAGGGGGGAGGGAGGGAAGAAGG - Intergenic
909488533 1:76200852-76200874 GTGGTGGTAAGGAGGCAGGATGG + Intronic
909602160 1:77472267-77472289 TATGCGTTAAGGAGGGCAGATGG - Intronic
909867425 1:80690964-80690986 CAGGTGGTTAGGAGGGAAGAAGG + Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
910521261 1:88124725-88124747 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
912249132 1:107992757-107992779 GAGCTGGTAAGTAGGGAAGCTGG + Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912708309 1:111931214-111931236 TAGGTGGGAAAGAGGTGAGAAGG + Intronic
912752668 1:112298639-112298661 AAGGAGGTATGGAGGAAAGAAGG + Intergenic
913502038 1:119480335-119480357 AGGGAGGGAAGGAGGGAAGAAGG + Intergenic
914442914 1:147722720-147722742 TGGGTGGTAAGGATTGAAGTGGG + Intergenic
914732704 1:150385916-150385938 TAGGTGGTGACAAGGGTAGAGGG + Intronic
914876683 1:151517477-151517499 TTGGTGGGAGGAAGGGAAGAAGG + Intronic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915599318 1:156912693-156912715 GAGGTGCTCAGGAGGGAAGTAGG - Intronic
915823444 1:159050644-159050666 GAGGAGGTATGGAGGCAAGAAGG - Intronic
916437469 1:164790498-164790520 TAGCTGGGAAGGAGAAAAGAAGG - Intronic
917189582 1:172400406-172400428 TAGGAAGAAAGGAGGGAAGGAGG + Intronic
917234160 1:172872862-172872884 GGGGAGGGAAGGAGGGAAGAAGG - Intergenic
917448242 1:175124785-175124807 GAAGTGGGAAAGAGGGAAGAAGG - Intronic
917482892 1:175427755-175427777 AAAGAGGGAAGGAGGGAAGAAGG - Intronic
917506607 1:175633063-175633085 TAGTTGTAAAGCAGGGAAGAGGG - Intronic
917840496 1:178973681-178973703 TGAGGGGTAAGGAGGGATGAGGG + Intergenic
918143459 1:181736716-181736738 TAGGTAGTGTGGAGGGAGGAAGG + Intronic
918594143 1:186273602-186273624 TAGGAAGAAAGGAGGGATGAAGG - Intergenic
919221132 1:194629906-194629928 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
920634482 1:207686180-207686202 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
920637454 1:207717904-207717926 GGGATGGTAAGGAGAGAAGAGGG + Intronic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
921294999 1:213693218-213693240 GAGGAGAGAAGGAGGGAAGAGGG - Intergenic
921305395 1:213791585-213791607 TGGGAGGTAAAGAGGGAGGAAGG + Intergenic
921519556 1:216142947-216142969 GAGGTGTTATGGAGAGAAGAGGG - Intronic
921582063 1:216906537-216906559 TGGCTGGTAGGGAGGGAAGTAGG - Intronic
922131691 1:222786700-222786722 TAGGTTTTAAGGAGGGGATAAGG - Intergenic
922265552 1:223980657-223980679 AAGGAGGGAAGGAGGGAAAAAGG + Intergenic
922448471 1:225717660-225717682 TTAGTGGTCAGGAGGGCAGATGG - Intergenic
922646405 1:227291174-227291196 CAGGTGGGGAGGAGGGAGGAAGG - Intronic
922719462 1:227892989-227893011 GAGGTGGTCAGCAGGGGAGATGG - Intergenic
922856665 1:228780890-228780912 GAGGAGGGAAGGTGGGAAGAAGG + Intergenic
922892637 1:229073390-229073412 TAGGAGGGAAGGAGGGGAGGAGG + Intergenic
923094886 1:230767401-230767423 TGGGTGGTGTGGAAGGAAGACGG - Intronic
923332957 1:232942566-232942588 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
923689258 1:236176745-236176767 TAAGAGGGAGGGAGGGAAGAAGG - Intronic
923989280 1:239416874-239416896 TAGTTGGTGAGGATGGAAGTGGG + Intronic
924347412 1:243085656-243085678 AAGGAGGGAAGGAGGGAAAAAGG + Intergenic
924602573 1:245504375-245504397 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1063235998 10:4117299-4117321 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1063247442 10:4236895-4236917 TGGGTGAAAAGGTGGGAAGAGGG - Intergenic
1063697979 10:8356353-8356375 AAGGAGGTAAGGAAGGAAGGAGG - Intergenic
1063783438 10:9352837-9352859 TAGGTTGTAAGTAGGGAAGTCGG - Intergenic
1064130855 10:12708427-12708449 TGGGTGGCAAGAAGGGAAGGGGG - Intronic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1064227821 10:13503169-13503191 CAGGTGGCAATGAGGGAGGAAGG + Intronic
1064402582 10:15033944-15033966 TAGGGAGAAAGGAAGGAAGAAGG + Intronic
1064474639 10:15674243-15674265 TATGTGGGATGGAGGAAAGAGGG - Intronic
1064533040 10:16329589-16329611 CGGGTGGGAAGGAGGGAAGGAGG + Intergenic
1065177682 10:23095408-23095430 CAGGTGGGAAGGAGGGAAGGAGG + Intergenic
1065198139 10:23286571-23286593 AGGGTGGGAAGGAGGGAAGGAGG + Intronic
1065631993 10:27690005-27690027 TAGGTGGTAATCATGGAAAAAGG - Intronic
1065874328 10:29983844-29983866 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1065886266 10:30080259-30080281 AAGATGGGAAGGAGGGAACAGGG - Intronic
1065930621 10:30475713-30475735 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1067424539 10:46195365-46195387 AAGGTGGAAAGGACGGAGGAAGG - Intergenic
1067720305 10:48723126-48723148 AGGGTGGAAAGGAGGGAAAAGGG - Intronic
1068120579 10:52779310-52779332 AAGGTGGGGAGGAGGGAAGCAGG - Intergenic
1068176270 10:53463550-53463572 TTGGTGGGGAGGAGGGTAGATGG - Intergenic
1068250728 10:54436080-54436102 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1069414424 10:68185163-68185185 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1069414427 10:68185171-68185193 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1069668717 10:70183477-70183499 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1070597904 10:77845589-77845611 ATGGAGGGAAGGAGGGAAGAAGG + Intronic
1070657042 10:78278774-78278796 AGGGAGGTAAGGAGGGAGGAAGG - Intergenic
1070720280 10:78752285-78752307 TACGTGGTAGGAAGGGGAGAAGG - Intergenic
1070973166 10:80584283-80584305 TAGGTGGTAACCAGTGCAGATGG + Intronic
1071522642 10:86340699-86340721 TAGAAGGGGAGGAGGGAAGAAGG + Intronic
1071998157 10:91166970-91166992 TAGGTGGTCAGGATGGGGGAGGG + Intronic
1072559705 10:96560144-96560166 TAGGTGGGAAAGAAGGCAGACGG - Intronic
1073464886 10:103688842-103688864 AAGGAGGGAGGGAGGGAAGAAGG - Intronic
1073583316 10:104686687-104686709 TTGATGACAAGGAGGGAAGAGGG - Intronic
1074014732 10:109522547-109522569 TAGGTGGTAAGGAAGAGATAAGG - Intergenic
1074052550 10:109893392-109893414 TCAGTGGCAAGGAGGGGAGAAGG - Intronic
1074103402 10:110371507-110371529 TAGGTGGGGAGGAGGGAAGAGGG + Intergenic
1074210656 10:111331058-111331080 CAGGAGGTAGGAAGGGAAGAAGG - Intergenic
1074326380 10:112455320-112455342 AAGGGGGGAAGGAGGGAAGGAGG - Intronic
1074326403 10:112455365-112455387 AAGGAGGGAAGAAGGGAAGAAGG - Intronic
1074326405 10:112455373-112455395 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
1074326407 10:112455381-112455403 AAGGGGGGAAGGAGGGAAGGAGG - Intronic
1074326431 10:112455428-112455450 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
1074326433 10:112455436-112455458 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1074326436 10:112455444-112455466 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1074326439 10:112455452-112455474 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1074827994 10:117228483-117228505 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1074963126 10:118465611-118465633 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1075198096 10:120378545-120378567 TGGGTGGAAAGGAGGGAGGTAGG + Intergenic
1075400477 10:122158006-122158028 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
1075400480 10:122158014-122158036 TAGGAGGGAAGGAGGGAAGGAGG - Intronic
1075963005 10:126585438-126585460 AAGAAGGAAAGGAGGGAAGAAGG + Intronic
1076427656 10:130379189-130379211 GAGGAGGGAAGGAGGGACGAAGG - Intergenic
1076973997 11:157433-157455 GAGGAGGGAAGGAGGGAAAAAGG + Intergenic
1077268574 11:1664624-1664646 GAGGAGGCAGGGAGGGAAGAAGG + Intergenic
1077336591 11:2007746-2007768 CAGGTGGTCAGGAAAGAAGATGG - Intergenic
1077779272 11:5307666-5307688 AAGGAGGGAAGGAGGGAAGGGGG - Intronic
1078421166 11:11214148-11214170 AATGTGGGAGGGAGGGAAGAAGG + Intergenic
1078859158 11:15231245-15231267 GAAGTGGTGTGGAGGGAAGAGGG + Intronic
1078859430 11:15233718-15233740 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
1078923665 11:15854527-15854549 TAGGGAGGAAGGAAGGAAGAGGG + Intergenic
1079321060 11:19451731-19451753 TAGCAGGAAAGAAGGGAAGAGGG + Intronic
1079329581 11:19522498-19522520 CGGCTGGTGAGGAGGGAAGAAGG - Intronic
1079528091 11:21414843-21414865 GAGGAGGGAAGGTGGGAAGAAGG - Intronic
1079817191 11:25076549-25076571 GAGGAGGGAAGGAGGGAAGGAGG + Intronic
1079879845 11:25913023-25913045 AAAGTGGGAAGGATGGAAGAGGG + Intergenic
1079908820 11:26284035-26284057 TGGGTGGTATGGCGGGAGGAGGG + Intergenic
1080156512 11:29117796-29117818 AAGGAGGGAAGGAGGGACGAAGG + Intergenic
1080156637 11:29118769-29118791 AAGGAGGGAAGGAGGGACGAAGG + Intergenic
1080302336 11:30798506-30798528 GAGGTGGAAAGGAGGGTAGTGGG - Intergenic
1080545098 11:33309269-33309291 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
1080828390 11:35867456-35867478 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1080972465 11:37294841-37294863 TAGAGGGTCAGGAGGGGAGAGGG + Intergenic
1081055935 11:38411297-38411319 GAGCTGATAAGAAGGGAAGAAGG + Intergenic
1081608054 11:44539687-44539709 TAGGTCTTAAGCAGGGAAGAGGG + Intergenic
1081722902 11:45303130-45303152 TAGCTGGTAAGGGGTGGAGATGG - Intergenic
1082227424 11:49725279-49725301 TATCTGGGGAGGAGGGAAGATGG + Intergenic
1082763619 11:57149355-57149377 AAGGAGGAAAGGAAGGAAGAGGG + Intergenic
1083116773 11:60467722-60467744 TAGGTGAAAAGGAGGGAAGAGGG - Intronic
1083313963 11:61802755-61802777 TGGCTAGTAGGGAGGGAAGAGGG - Intronic
1084580525 11:70020297-70020319 TGGGTGGTGAGGATGGAAGAAGG - Intergenic
1084699391 11:70776688-70776710 TAGGTGGGTAGGTGGGAGGATGG - Intronic
1084742675 11:71149809-71149831 TAGGTGAGAGGGAGGAAAGAAGG + Intronic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085238649 11:75033976-75033998 TAGGTGGGTAGGTGGGAAGGTGG - Intergenic
1085389242 11:76174060-76174082 TAGCTGGTAGAGAGGGAAGAGGG + Intergenic
1085542953 11:77289379-77289401 GAGGGGAAAAGGAGGGAAGACGG + Intronic
1085630750 11:78114566-78114588 AAGGTGGTAATGGGGGAAAATGG + Intronic
1086307165 11:85493797-85493819 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
1086393278 11:86388193-86388215 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1086453684 11:86941339-86941361 TTTGTGGGAAGGAGGGTAGAGGG + Intronic
1086803878 11:91214743-91214765 AGGGAGGGAAGGAGGGAAGAAGG + Intergenic
1087237172 11:95733044-95733066 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1087472439 11:98593762-98593784 TAGCTGTTATGGAGGTAAGAAGG - Intergenic
1087552764 11:99672855-99672877 CAGGTGGAAAGGAAAGAAGATGG + Intronic
1087786223 11:102357247-102357269 GAGGGAGTAAGGAGGGAGGAGGG - Intronic
1087906094 11:103699691-103699713 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1088623961 11:111715261-111715283 GAGGTCTTAGGGAGGGAAGAGGG - Intronic
1088634039 11:111802114-111802136 AAGTTGGTAAGGAGGGAAGTTGG - Intronic
1089489778 11:118875250-118875272 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1089659670 11:119977767-119977789 TATGTGGGAAGGAGGTAAGGGGG + Intergenic
1089733734 11:120535387-120535409 AGGGAGGGAAGGAGGGAAGAAGG + Intronic
1089791363 11:120946970-120946992 AAGTTGGTATGGAGGGAAAATGG - Intronic
1090134522 11:124183539-124183561 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1090386363 11:126359732-126359754 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1090386366 11:126359740-126359762 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1090433926 11:126670166-126670188 TAGGTGGCAAGGAGAGAAGCAGG - Intronic
1090493524 11:127187864-127187886 AAGGAGGGAAGGAAGGAAGATGG + Intergenic
1090634636 11:128683352-128683374 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1090971754 11:131649879-131649901 TAGATCGTAAGGTGGGAAGGGGG - Intronic
1202819575 11_KI270721v1_random:62928-62950 CAGGTGGTCAGGAAAGAAGATGG - Intergenic
1091543914 12:1487750-1487772 TAGGAGGCAAGGAGGGAGGGAGG + Intronic
1091750956 12:3020943-3020965 GAGGAGGGAAAGAGGGAAGAGGG - Intronic
1091831183 12:3552254-3552276 CAGGTGGTAAAGAGAGAAGAGGG + Intronic
1091901221 12:4145618-4145640 TGGGTAGTAAGAAGGGGAGAGGG - Intergenic
1092744371 12:11659826-11659848 TAAGAGGTGAGGAAGGAAGAGGG + Intronic
1092753202 12:11738233-11738255 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1093141620 12:15516538-15516560 AAGGAGGGAGGGAGGGAAGAAGG + Intronic
1093959845 12:25260276-25260298 AGGGTGGCAAGGAGGGAAGAAGG - Intergenic
1093967712 12:25345023-25345045 TGGGGGGGAAGTAGGGAAGAAGG + Intergenic
1094220118 12:27983918-27983940 TGGGGGGAAAGGATGGAAGATGG + Intergenic
1094589074 12:31804405-31804427 TGGGAGGGAAGGAGGGCAGAAGG - Intergenic
1094615076 12:32029232-32029254 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1095700925 12:45190087-45190109 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1096340694 12:50796287-50796309 TAGAGGCTAAGGCGGGAAGATGG + Intronic
1096583311 12:52602164-52602186 TATCTGGGAGGGAGGGAAGAAGG + Intergenic
1096943188 12:55372461-55372483 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1096943190 12:55372469-55372491 AAGGAGGGAAGGAGGGAAGCAGG + Intergenic
1096944176 12:55385965-55385987 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1097023651 12:56037685-56037707 CAGGTGCTAAGGAGGGGAGAGGG + Exonic
1097236175 12:57541386-57541408 AAGGTGGTGAGGAGGGAGGATGG + Intronic
1097608433 12:61785098-61785120 CAGGAGGGAAGGAGGGAATAGGG - Intronic
1097623808 12:61975301-61975323 TGGGTGGAAGTGAGGGAAGAAGG - Intronic
1097934739 12:65233722-65233744 TAGTTAGTAAGAAGGGAAAAAGG - Intronic
1098567922 12:71956472-71956494 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1098567935 12:71956508-71956530 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1098567944 12:71956536-71956558 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1098573527 12:72015132-72015154 TAGGTGGTAAAGGGGTAAGTGGG + Intronic
1098740941 12:74172272-74172294 TTGGTGGAAAGCAGGGAAAATGG + Intergenic
1099669268 12:85669569-85669591 TAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1100137107 12:91566977-91566999 AAGGTGGGAAGGAAGGAAGGTGG - Intergenic
1100295502 12:93257315-93257337 TATGTGGGCAGGAGGGAAAAGGG - Intergenic
1100577091 12:95902366-95902388 GAGGTGGGGAGGAGGGAAGAAGG - Intronic
1101036131 12:100708476-100708498 AAGAAAGTAAGGAGGGAAGAAGG - Intergenic
1101063069 12:100991479-100991501 TAGGGGGTGAGGTGGGAGGAGGG + Intronic
1101638305 12:106565878-106565900 AAGGGGGTAGGGAGGGAGGAAGG + Intronic
1102543490 12:113638460-113638482 TAGGCGGGTAGGAGGGAAGAAGG + Intergenic
1102567467 12:113805946-113805968 CAGGTGGTAACTAGGGAAGTGGG + Intergenic
1102744972 12:115242467-115242489 GAGCCGGTAAGGAGGGGAGAAGG - Intergenic
1102982098 12:117250083-117250105 GAGATGGGAAGGAAGGAAGAAGG + Intronic
1102992137 12:117322814-117322836 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1103425480 12:120830334-120830356 GAGGTGGAAAGGAGGGGGGAGGG + Intronic
1103956804 12:124581979-124582001 TAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1103962849 12:124620244-124620266 GAGGTGGGAAGGAGGCAAAAGGG - Intergenic
1104481848 12:129114401-129114423 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1104481851 12:129114409-129114431 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1104990288 12:132620662-132620684 CAGCTGGTCAGGAGGGAGGAGGG - Intronic
1106046333 13:26145534-26145556 TAGGAGGCAAAGAGAGAAGAAGG - Intronic
1106302007 13:28475596-28475618 TTGGTGGCAAGGATGGGAGAAGG + Intronic
1106512224 13:30421867-30421889 GAGGTGGTAAGGAGAGGAGCGGG + Intergenic
1106578623 13:30999091-30999113 AAGGTAGGAAGGAGAGAAGAGGG + Intergenic
1106842404 13:33698263-33698285 TAGGGGTTAGGGTGGGAAGAGGG - Intergenic
1107917659 13:45168951-45168973 AAGGAGGTAAGGAGGGAAAGAGG - Intronic
1108498399 13:51046430-51046452 AAGGAGGGAATGAGGGAAGAAGG + Intergenic
1108822334 13:54368646-54368668 AAGGAGGGAAGGAGGGAAGAAGG + Intergenic
1108822342 13:54368670-54368692 AAGGAGGGAAGGAGGGAAGAAGG + Intergenic
1109512827 13:63402003-63402025 AAGGAGGGAAGGAAGGAAGAAGG - Intergenic
1109529838 13:63627620-63627642 TACGTGGTAATGAGAGAAAAAGG + Intergenic
1109673792 13:65645402-65645424 TTGGTGCTAAGAATGGAAGAAGG - Intergenic
1110102570 13:71627880-71627902 ATGGTGGTAAGAAAGGAAGAAGG + Intronic
1110552906 13:76828024-76828046 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1110586421 13:77199024-77199046 TAGGGGGGGAGGAGGCAAGATGG + Intronic
1110862682 13:80360043-80360065 TCGGAGGTGAGGAGTGAAGAAGG + Intergenic
1110879381 13:80552602-80552624 TGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1110950864 13:81488924-81488946 TGGATGGCAAGGAAGGAAGAAGG - Intergenic
1111446192 13:88348118-88348140 AAGGAAGGAAGGAGGGAAGAAGG + Intergenic
1111759068 13:92438787-92438809 TAGGTGTGAAGGAGGAAAGGAGG + Intronic
1112119644 13:96395853-96395875 AAGGAGGAAAGGAAGGAAGAAGG + Intronic
1112261766 13:97884042-97884064 TGGGTGGCAAGCAGGGGAGAGGG + Intergenic
1112450259 13:99501552-99501574 TAGGGGGTCAAGAGGGAAGGAGG - Exonic
1112926291 13:104679095-104679117 TAGGAGATAAGGAGGCAATAAGG + Intergenic
1113391315 13:109899994-109900016 AAGGTGGGAAGGAGGAAAAAGGG - Intergenic
1113664097 13:112128815-112128837 AAGGAAGAAAGGAGGGAAGAAGG - Intergenic
1114317972 14:21524888-21524910 TGGGTGGTAAAGGTGGAAGAAGG + Exonic
1114411981 14:22509475-22509497 TAGGTGGAAAGGATGGCTGAAGG + Intergenic
1114415568 14:22540989-22541011 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1114653493 14:24301717-24301739 TTGCAGGTAAGGAGGGAAGTAGG + Exonic
1115147219 14:30239566-30239588 TAGGGGGAAAGGAGGAAGGAGGG - Intergenic
1115243562 14:31272680-31272702 CAGGTGGCAAAGAGGGAAGGAGG - Intergenic
1115356566 14:32454664-32454686 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1115374665 14:32661096-32661118 TAGGTAGAAAGGAGGTCAGAAGG + Intronic
1115644906 14:35362272-35362294 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1116239982 14:42328272-42328294 AAGGTGATAAAGAGGGAAAAAGG - Intergenic
1116375836 14:44199544-44199566 AGGGAGGGAAGGAGGGAAGAGGG + Intergenic
1116409567 14:44606003-44606025 TTGCTGGTAAGGATGGAGGAAGG - Intergenic
1116659585 14:47692081-47692103 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1116743659 14:48790524-48790546 AAGGATGAAAGGAGGGAAGAAGG + Intergenic
1117764331 14:59064796-59064818 AAGGGGGAAAGGAAGGAAGAAGG + Intergenic
1117971342 14:61253959-61253981 GAGGAGGGAGGGAGGGAAGAAGG - Intronic
1118133013 14:62988892-62988914 TGGGTGATAAAGGGGGAAGATGG - Intronic
1118594650 14:67426276-67426298 TAGTTGCTGAGGAGGGTAGAGGG + Intergenic
1118600322 14:67467452-67467474 TGGGTGGGAAGGAGGGAGGGAGG + Intronic
1118605040 14:67496675-67496697 TAGGAAGAAAGGAGGGAGGAAGG - Intronic
1118837305 14:69485936-69485958 TGGGAGGTATTGAGGGAAGAGGG + Intronic
1118856347 14:69626216-69626238 AAGGTGGGAAGGTGGGAAGCCGG - Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1118905491 14:70020481-70020503 TAGCTGGGAAGGAGGAAGGAAGG + Intronic
1119002631 14:70896679-70896701 AAGGGGGGAAGGAAGGAAGAGGG + Intergenic
1119182774 14:72615592-72615614 TGGGTGGAAGGGAGGGAAGGAGG - Intergenic
1119205170 14:72788641-72788663 GAGGTGGGGAGGAGGGCAGAGGG - Intronic
1119431207 14:74569149-74569171 ATGGAGGGAAGGAGGGAAGAAGG + Intronic
1119620776 14:76130460-76130482 AAAGTGGGAAGGAGTGAAGAAGG + Intergenic
1119884646 14:78130079-78130101 TAGGTGAAAAGGGAGGAAGAGGG - Intergenic
1119904472 14:78288996-78289018 TAGGTGGTGAGGACTGAACATGG + Intronic
1120012012 14:79426708-79426730 TAGGTGTTGAGGATGGGAGAAGG + Intronic
1120750639 14:88194618-88194640 GAGATGGGCAGGAGGGAAGATGG + Intronic
1120844992 14:89117630-89117652 AGGGTGGGAGGGAGGGAAGAGGG + Intergenic
1120933534 14:89872226-89872248 TAGGTGGCCAGGAGGAAACATGG - Intronic
1121614273 14:95302348-95302370 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
1121623004 14:95363164-95363186 GAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1121983129 14:98472327-98472349 TGGGTGGTCAGTAGGAAAGATGG - Intergenic
1122766347 14:104073715-104073737 TGGGTGGTAATGAGGGTAAAGGG + Intergenic
1122874102 14:104655274-104655296 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1122874105 14:104655282-104655304 AAGGAGGGAAGGAGGGAAGGTGG + Intergenic
1123434825 15:20247535-20247557 AAAGAGGAAAGGAGGGAAGAAGG + Intergenic
1123541126 15:21292741-21292763 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1124172398 15:27387901-27387923 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1124439173 15:29674733-29674755 GAGGAGGGAAGGAGGGAAAAGGG + Intergenic
1124850727 15:33336503-33336525 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1124850730 15:33336511-33336533 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1124850733 15:33336519-33336541 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1124850736 15:33336527-33336549 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1125278624 15:38020527-38020549 TAAGAGGTAAGGTGGGAAAAAGG + Intergenic
1125408828 15:39383513-39383535 TAGTGGGTAAGGTGGGAAAAGGG + Intergenic
1125445214 15:39747004-39747026 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1125445217 15:39747012-39747034 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1125445220 15:39747020-39747042 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1126320641 15:47419041-47419063 AAGCTGGAAAGGAGAGAAGAGGG + Intronic
1126350130 15:47737090-47737112 TAGGAGGTAAGAAGGAAAAAGGG + Intronic
1126897507 15:53274948-53274970 AGGGTGGGAAGGAGGGAGGAAGG - Intergenic
1127507512 15:59610746-59610768 AGGGAGGTAAGGAGGGAAGGAGG - Intronic
1127907584 15:63387674-63387696 GAGGGAGGAAGGAGGGAAGAAGG + Intergenic
1128117017 15:65114629-65114651 TAGGTGCTAGGGATGTAAGAAGG - Intronic
1128147462 15:65339966-65339988 TAGGTGGGGAGAAAGGAAGAAGG + Intronic
1129180967 15:73875290-73875312 AAGGAGGGAAGGAGGGAAGAAGG + Intronic
1129464266 15:75715153-75715175 TAGGTGGGGAGCAGGGAAGATGG - Intergenic
1129634891 15:77305152-77305174 AAGGAAGGAAGGAGGGAAGAAGG + Intronic
1129720983 15:77877859-77877881 TAGGTGGGGAGCAGGGAAGATGG + Intergenic
1129830257 15:78664592-78664614 TAGGTGGTGAGCAGGGGAGGAGG - Intronic
1129917790 15:79289654-79289676 AAGGTGGGAAGGAGGGTGGATGG - Intergenic
1129983870 15:79898580-79898602 TGGGAAGGAAGGAGGGAAGAGGG + Intronic
1129990799 15:79960642-79960664 AAGGAAGGAAGGAGGGAAGAGGG + Intergenic
1130468135 15:84203084-84203106 TACCTGGGAAGGAGGGAAGGGGG - Intergenic
1130590428 15:85207682-85207704 TACCTGGGAAGGAGGGAAGGGGG - Intergenic
1130847158 15:87758177-87758199 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1131003326 15:88955567-88955589 TGGGTGGTGAGGAAGGAAAAGGG + Intergenic
1131065612 15:89433393-89433415 TTGGAGGGAGGGAGGGAAGAAGG - Intergenic
1131097138 15:89663329-89663351 TGGGGGGTGGGGAGGGAAGATGG - Intergenic
1131793322 15:95988363-95988385 AAGGAGGGAAGGAAGGAAGAAGG + Intergenic
1131860619 15:96649598-96649620 TAGCTGGGGAGGAGGGATGATGG - Intergenic
1132362126 15:101225171-101225193 TTGGAGGTGAGGTGGGAAGATGG - Intronic
1202949439 15_KI270727v1_random:19882-19904 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1133402662 16:5500117-5500139 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1133402665 16:5500125-5500147 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1134185198 16:12079532-12079554 TTGTTGCTAAGGAAGGAAGAAGG + Intronic
1134258884 16:12634550-12634572 AAGATGGGAAAGAGGGAAGAGGG + Intergenic
1134284047 16:12844668-12844690 TAGCTTGTAAGCAAGGAAGATGG + Intergenic
1134375536 16:13669339-13669361 AAGGTGGTCAGGAGGGCAGATGG + Intergenic
1134833134 16:17339831-17339853 AAGGAGGGAAGGAAGGAAGAAGG - Intronic
1134991255 16:18701566-18701588 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1135263325 16:21000003-21000025 AAGGAGAAAAGGAGGGAAGAAGG + Intronic
1135661687 16:24302557-24302579 TAGGGGCTGAGGTGGGAAGATGG - Intronic
1135681790 16:24463476-24463498 TGGGGGGAAAGGAGGGGAGATGG + Intergenic
1135838460 16:25850826-25850848 TCTGTGTTAAGGAGGGAACAGGG + Intronic
1135887697 16:26326472-26326494 GAGGAAGGAAGGAGGGAAGAAGG + Intergenic
1135887707 16:26326504-26326526 AAGGAGGAAAGGAGGGAAGAAGG + Intergenic
1136375738 16:29864039-29864061 AAGGTGCTTGGGAGGGAAGAAGG + Intergenic
1137219836 16:46437618-46437640 AAGGAGGAAATGAGGGAAGAAGG - Intergenic
1137581181 16:49634522-49634544 GAGGGGGTGAGGAGGGCAGAGGG - Intronic
1137801025 16:51262163-51262185 AAGGAGGGAAGGAGGGAAGGGGG - Intergenic
1137897968 16:52234583-52234605 TAGGTGGGAATGACCGAAGAGGG - Intergenic
1138264154 16:55647420-55647442 AAGGAGGGAAGGAGGGAAGACGG + Intergenic
1138491005 16:57376624-57376646 CAGGTGGTAGGTAGGGGAGAGGG + Intronic
1138585347 16:57966237-57966259 TAGGTGGAGAGGAGGGAACGTGG - Intronic
1138697769 16:58831786-58831808 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697772 16:58831794-58831816 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697775 16:58831802-58831824 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697778 16:58831810-58831832 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697781 16:58831818-58831840 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697784 16:58831826-58831848 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697787 16:58831834-58831856 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697790 16:58831842-58831864 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697793 16:58831850-58831872 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138969591 16:62128764-62128786 GAGGTGGAGAGGAGAGAAGAAGG - Intergenic
1138972057 16:62157309-62157331 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1139253531 16:65519566-65519588 GAGGTAGAAAGGAGGGAGGAAGG - Intergenic
1139327233 16:66161863-66161885 TAGTTGGTAAGGGGAAAAGAAGG + Intergenic
1140231016 16:73117203-73117225 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1140257524 16:73349796-73349818 AAGGAGGGAGGGAGGGAAGAGGG - Intergenic
1140286704 16:73609658-73609680 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1140306446 16:73807308-73807330 AAGGAAGAAAGGAGGGAAGAAGG - Intergenic
1140725459 16:77807541-77807563 TAGATGGGCAGGAGGGAAGCTGG - Intronic
1140820212 16:78656516-78656538 TAGGAGGCAAGGAGCGAAGGAGG + Intronic
1141090848 16:81129364-81129386 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1141427171 16:83951967-83951989 AAGGAGGTAGGGAGGGAAGCAGG - Intronic
1141734690 16:85844326-85844348 AAGGAAGGAAGGAGGGAAGAAGG - Intergenic
1142030651 16:87836809-87836831 AAGGAGGAAAGGAGGGAAGGAGG + Intronic
1142308104 16:89296917-89296939 CAGGTGCTGAGGAGGGATGAGGG - Intronic
1142446266 16:90140252-90140274 GAGGAGGGAAGGAGGGAAAAAGG - Intergenic
1142461239 17:95211-95233 GAGGAGGGAAGGAGGGAAAAAGG + Intergenic
1142654973 17:1385640-1385662 GAGGAGGGAAGGAAGGAAGACGG + Intronic
1143737356 17:8922134-8922156 AAGGAGGGAAGGAGGGAAGGTGG + Intronic
1144230608 17:13199526-13199548 AAGGAGGGAAGGAGGAAAGATGG - Intergenic
1144234407 17:13243643-13243665 TAGGTGGAACTGAGGGAAGGTGG - Intergenic
1144346778 17:14356545-14356567 TAGGGGGTAAGGAGGCAGGAAGG + Intergenic
1144380179 17:14687190-14687212 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1144511590 17:15881782-15881804 TAGGGGCTACGGAGAGAAGAAGG - Intergenic
1145742274 17:27285325-27285347 TTGGGGGTAAGGAGAGGAGAGGG + Intergenic
1145886818 17:28387824-28387846 TTGGTGGGAAATAGGGAAGAAGG + Intronic
1146151328 17:30475258-30475280 TTGATGGCAAGGAGTGAAGATGG - Intergenic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146667592 17:34715363-34715385 TAGATGTTTAGGAGGGAAAAGGG + Intergenic
1147279936 17:39350861-39350883 TAGGTGGGCAGGAGAGAAAATGG + Intronic
1147617408 17:41837699-41837721 GGGGTGGTAAGGAGGGGAGAAGG + Intronic
1147839162 17:43358389-43358411 TAGGTGGCAAATCGGGAAGAGGG - Intergenic
1147943878 17:44069299-44069321 AAGGTGTAAAGGAGGGAAGCTGG - Intergenic
1148026495 17:44592723-44592745 AGGGAGGTAGGGAGGGAAGAAGG + Intergenic
1148346032 17:46904209-46904231 TGGGTGGGAAGGTGGGTAGATGG + Intergenic
1149520985 17:57318190-57318212 AAGGTGGGAAGGTGGGAAGGTGG + Intronic
1149520988 17:57318198-57318220 AAGGTGGGAAGGTGGGAAGGTGG + Intronic
1149914061 17:60592262-60592284 TAGGTACTAAAGGGGGAAGAGGG + Intergenic
1150006579 17:61473535-61473557 TGGGAGGAAAGGAGGAAAGAGGG - Intronic
1150062394 17:62079821-62079843 TTGGTGATAAGAAAGGAAGATGG + Intergenic
1150597217 17:66616810-66616832 TAGGTGGTAAGGAGGCACAGAGG + Intronic
1150859447 17:68786326-68786348 AAGGAGGGAGGGAGGGAAGAGGG - Intergenic
1151050972 17:70978465-70978487 GAGGGTGGAAGGAGGGAAGAAGG + Intergenic
1151433738 17:74081580-74081602 GAGGTGGTAAGGGGAGAGGAGGG - Intergenic
1151586016 17:75008978-75009000 GTGGTGATCAGGAGGGAAGAAGG - Intergenic
1151624293 17:75267072-75267094 TGGATGGTAAGGAGGGAGCAAGG - Intronic
1151996101 17:77610016-77610038 AAGGGGGTGAGGAAGGAAGAGGG + Intergenic
1152003216 17:77660286-77660308 AAGAAGGAAAGGAGGGAAGAAGG - Intergenic
1152089573 17:78239260-78239282 CAGGTGGGAGGGAGGTAAGAGGG + Exonic
1152307166 17:79527906-79527928 AAGGTGTTAAGGAGCGGAGAGGG - Intergenic
1152410606 17:80120681-80120703 GAGGAGGTGAGGAGGGGAGAGGG - Intergenic
1152891043 17:82881925-82881947 TAGGAGGGAGGGAGGGAGGAAGG - Intronic
1153463266 18:5361120-5361142 AAGGTGGTATGGACTGAAGAGGG - Intergenic
1153836620 18:8969751-8969773 AAGGTGGAAGGGAGGGAAGGGGG - Intergenic
1154031218 18:10755964-10755986 TAGGGGATGAGGAGGAAAGATGG + Intronic
1154031253 18:10756102-10756124 TAGGGGATGAGGAGGAAAGATGG + Intronic
1154154728 18:11934964-11934986 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1154412204 18:14147504-14147526 TGGGAGGGAAGGAGGGAAGGAGG + Intergenic
1155188785 18:23411153-23411175 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1155878665 18:31117507-31117529 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1155936777 18:31762855-31762877 TAGGGGGTAAGGAAAGGAGAAGG + Intergenic
1156368538 18:36451736-36451758 GAGGTGGGAGGGAGGGAAGCAGG + Intronic
1157367708 18:47081071-47081093 ATGGAGGGAAGGAGGGAAGAAGG - Intronic
1157517324 18:48320285-48320307 TAGATGGGTAGGTGGGAAGATGG + Intronic
1157678524 18:49585797-49585819 TGGGTGAAAAGGAGGGAAAAGGG - Intronic
1157966244 18:52211493-52211515 TAGGAGGTAAAGAAGGAGGAGGG + Intergenic
1159356114 18:67338437-67338459 AGGGAGGAAAGGAGGGAAGAAGG - Intergenic
1160086685 18:75783159-75783181 TTGCTGGATAGGAGGGAAGAGGG - Intergenic
1160087300 18:75788502-75788524 TAGGTGGAAGGAAGGGAAGAAGG - Intergenic
1160150528 18:76393424-76393446 CAGGTGGTCAGGTGGGAAGCCGG + Intronic
1160150788 18:76394070-76394092 CAGGTGGTCAGGTGGGAAGCCGG + Intronic
1160150938 18:76394448-76394470 CAGGTGGTCAGGTGGGAAGCCGG + Intronic
1160248409 18:77179760-77179782 AACGCGGTAAGGAGGGAAGGAGG + Intergenic
1160279222 18:77471532-77471554 AAGGTGGGAAGCAGGGGAGATGG - Intergenic
1160295022 18:77630008-77630030 TGGGAGGAAAGGAGGGAAGGAGG - Intergenic
1160469656 18:79117592-79117614 TAGTTGGAAAGGAGGTCAGAGGG + Intronic
1160650940 19:227578-227600 GAGGAGGGAAGGAGGGAAAAAGG + Intergenic
1160888178 19:1362036-1362058 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1161347099 19:3773923-3773945 AAGGTGGTGAGAATGGAAGATGG + Intergenic
1161827849 19:6581046-6581068 AAGGAGGGAAGGAGGGAAGAAGG - Intergenic
1161994235 19:7702661-7702683 TAGGAGGGAAGGAGGGAAGCGGG + Intergenic
1162697362 19:12486467-12486489 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1162697365 19:12486475-12486497 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1162697368 19:12486483-12486505 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1162697371 19:12486491-12486513 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1162855596 19:13465999-13466021 AAGGTGGTGGGGAGGGGAGAAGG + Intronic
1163093282 19:15036116-15036138 AAGGAGGGAAGGAAGGAAGAGGG + Intergenic
1163682042 19:18688340-18688362 TGGGTGGAAAGCAGGGAGGAGGG + Intronic
1163689527 19:18730962-18730984 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1164324460 19:24179717-24179739 GAGGAAGTAAAGAGGGAAGAAGG + Intergenic
1164393569 19:27845562-27845584 TGGGTGGTTAGGAGAGAGGAGGG + Intergenic
1164423023 19:28113937-28113959 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1164522251 19:28988465-28988487 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1164588751 19:29494674-29494696 CGGGTGGTAAGGAGGGAAGAAGG + Intergenic
1164588753 19:29494682-29494704 AAGGAGGGAAGAAGGGAAGAAGG + Intergenic
1164750954 19:30654368-30654390 GGGGTGGTGAGGAGTGAAGAGGG - Intronic
1165331392 19:35142795-35142817 TGGGAGGGAAGGAGGGAGGAAGG + Intronic
1165489820 19:36116499-36116521 GAGGTGGAAAGGAGGGAGCAGGG + Intronic
1165799309 19:38537856-38537878 TAGGTGGAAGGGAGGGGACAGGG - Intronic
1166088746 19:40494303-40494325 AAGGAGGAAAGGAGGGAAGGAGG - Intronic
1166105162 19:40594558-40594580 GAGGTGGTGAGGGGGGAAGCGGG + Intronic
1166191325 19:41178795-41178817 GAGGGGCCAAGGAGGGAAGATGG + Intergenic
1166646118 19:44533038-44533060 GAGGTGGTGGGGAGGGAAGCTGG - Intergenic
1166911279 19:46160072-46160094 AAGGTGATAAGGAAGGAGGAAGG - Intronic
1167062958 19:47162584-47162606 TAGGGGGTGGGGAGGGTAGAGGG - Intronic
1167435215 19:49475062-49475084 GAGATGGACAGGAGGGAAGATGG + Intronic
1167602011 19:50459842-50459864 GAGGAGGTGAGGAGGGATGAGGG + Intronic
1168109193 19:54182032-54182054 AAGGAGGGAAGGAAGGAAGAAGG + Intronic
1168220365 19:54956141-54956163 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1168346693 19:55653258-55653280 TGGGTGGTCAGGCGGGAGGACGG + Intergenic
1168433914 19:56302707-56302729 GAGGTGGGAGGGAGGGAAGAAGG - Intronic
925105586 2:1287978-1288000 CAGGTGGTCAGGATGGAAGCTGG - Intronic
925466455 2:4110862-4110884 AAGGTGGGAAGGAGGGAGGGAGG - Intergenic
925705439 2:6680566-6680588 GAGGTGGTAAGGAGGAGAGATGG + Intergenic
927103429 2:19805237-19805259 GAGGATGTGAGGAGGGAAGAAGG + Intergenic
927315847 2:21681040-21681062 GAGGTGGGAGGGAGGGAAGGAGG + Intergenic
927464292 2:23325441-23325463 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
928417690 2:31110193-31110215 TAGGAGGTAAGAAAGGGAGAAGG - Intronic
928426606 2:31183771-31183793 AAGGAGGGAAGAAGGGAAGAAGG - Intronic
928744385 2:34394571-34394593 TAGGAGGGAAGGGGGGAAGGCGG - Intergenic
929342202 2:40834242-40834264 CAGATGGGAAGGAGGGAGGAAGG - Intergenic
929342220 2:40834295-40834317 AAGGAAGGAAGGAGGGAAGAAGG - Intergenic
929635973 2:43521166-43521188 AAGGAGGGAGGGAGGGAAGAAGG + Intronic
929688027 2:44051340-44051362 GAGGTGGTAATGAGCCAAGATGG - Intergenic
929914372 2:46121963-46121985 AAGGAGGGAAGGAGGGAAAAAGG - Intronic
929960604 2:46493417-46493439 AAGATGGGAAGGAGGGAAAAAGG - Intronic
930047708 2:47187835-47187857 GAGGTGATAAGGGTGGAAGATGG - Intergenic
930312243 2:49755928-49755950 AGGGTGGAAAGGAGGGAAGGGGG + Intergenic
930365435 2:50433731-50433753 AAGGTGGAAGGGAGGGAAGGAGG + Intronic
930372846 2:50526007-50526029 TGGGAGGTGAGGAGGGTAGAGGG - Intronic
930406267 2:50960326-50960348 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
930424963 2:51201626-51201648 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
930612869 2:53562760-53562782 GAGGTGGGGAGGTGGGAAGATGG + Intronic
930785162 2:55264691-55264713 TAGGGGGTGAGATGGGAAGATGG - Intronic
931130073 2:59326303-59326325 TAGATGGGAAGGAGCCAAGATGG + Intergenic
931321090 2:61175650-61175672 TAAGAGGTAGGCAGGGAAGAGGG - Intergenic
932080014 2:68705500-68705522 TCGGTGGTCACGAGGCAAGATGG + Intronic
932475390 2:72002820-72002842 TAGGTGGCCAGGAGGGAAGCAGG - Intergenic
933811561 2:86035873-86035895 TAGGAGGGAAGGAGGTGAGAAGG + Intronic
934112091 2:88753525-88753547 TAGGTAGAAAGGAGGAAAAAAGG - Intergenic
934754027 2:96812856-96812878 TAAGTGCTATGGAGGGAAAAAGG - Intergenic
935420822 2:102867009-102867031 AAGGAGGCAAAGAGGGAAGAAGG + Intergenic
935648490 2:105361897-105361919 TGGGTGGGAATGAGGGGAGAGGG + Intronic
936416705 2:112322108-112322130 AAGGAGGGAAGGAGGGAAGACGG - Intronic
936416707 2:112322116-112322138 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
936416710 2:112322124-112322146 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
936555859 2:113498515-113498537 GAGGTGGGAAGGAAGGTAGAAGG + Intergenic
936768865 2:115887559-115887581 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
937193796 2:120131873-120131895 TAGATGTTTAGGAGGGAAGGGGG + Intronic
937239392 2:120450592-120450614 CAGGTGGGAGGGAGGGAAGATGG - Intergenic
937615844 2:123921397-123921419 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
937641074 2:124212347-124212369 TAGATGGGGAGGAGGGAAAAGGG + Intronic
937683881 2:124674352-124674374 AAGGAGGGAGGGAGGGAAGAAGG - Intronic
938928243 2:136063820-136063842 TAAGAGGTAATGAGGGGAGAAGG - Intergenic
939280475 2:140057922-140057944 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
940653337 2:156459323-156459345 TAGGTGGTAAAAATGGCAGAAGG + Intronic
940702743 2:157066308-157066330 AAGGAGGAAAGGAAGGAAGAAGG - Intergenic
941114323 2:161454277-161454299 TGGGAGGGATGGAGGGAAGAAGG - Intronic
941201225 2:162513270-162513292 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
941541396 2:166790142-166790164 GAGGGGGGAAGGTGGGAAGAGGG - Intergenic
941633298 2:167908014-167908036 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
942113558 2:172706136-172706158 TAAGTAGTAAGGAGGGACAAGGG - Intergenic
942183394 2:173402143-173402165 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
942349295 2:175036216-175036238 GAGGAGGGAAGGAGAGAAGATGG + Intergenic
942364508 2:175209379-175209401 CAGGAGTTAAGGAGGAAAGAGGG - Intergenic
942602411 2:177654823-177654845 TGGGAGGAAAGGAGGGAGGAAGG - Intronic
942655302 2:178208741-178208763 AAGGAGGGAAAGAGGGAAGAAGG - Intronic
942978270 2:182046136-182046158 AAGGAGGAAAGGAAGGAAGAAGG - Intronic
943395988 2:187335117-187335139 AAGGTGGGAAGGTGGGAGGAAGG + Intergenic
943860627 2:192857754-192857776 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
944649927 2:201819587-201819609 TAGGAGGAAAGCAGGGAAGCAGG + Intronic
944775557 2:202960710-202960732 AAGGTGGGAAGGCGGGAAGGCGG - Intronic
944922458 2:204429583-204429605 GTGGTGATAAGGAGGGAAGCAGG + Intergenic
945027017 2:205629427-205629449 TAGGGGGTCGGGAGGCAAGATGG - Intergenic
945268791 2:207917975-207917997 TAGGGGGTGAGGGGAGAAGAGGG + Intronic
945876067 2:215279725-215279747 AAGGAAGGAAGGAGGGAAGAAGG + Intergenic
946129403 2:217594122-217594144 TAGGGGATAAGAAGGGAGGAAGG + Intronic
947305330 2:228740285-228740307 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
948358227 2:237397517-237397539 AAGGTGGGAAGGTGGGAGGAAGG + Intronic
948434933 2:237946609-237946631 AAGGAGGGAAGGAAGGAAGAAGG + Intergenic
948965244 2:241374568-241374590 GGGGTGGGAAGGAGGGAAGAGGG + Intronic
1168848711 20:961976-961998 TGGGTGGATAGGAGGGTAGATGG - Intronic
1168869925 20:1119258-1119280 TGGGTGGTAAGGAGTTCAGACGG - Intronic
1168960061 20:1862887-1862909 GAGGAGGGAAGGAGGGAACATGG - Intergenic
1168960063 20:1862895-1862917 TTGGTGGAGAGGAGGGAAGGAGG - Intergenic
1169253019 20:4074668-4074690 CAGGTGGTAAAGGGGCAAGAAGG - Intronic
1169363015 20:4967458-4967480 AAGAAGGTAAGGAAGGAAGATGG - Intronic
1169766738 20:9154888-9154910 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1169967481 20:11234116-11234138 GATGTGGTAAGGAGAGATGAAGG - Intergenic
1170034719 20:11978421-11978443 AAGGCGGGAGGGAGGGAAGAAGG - Intergenic
1170132174 20:13032546-13032568 TGGGTGGAAATGAGGGAACATGG - Intronic
1170278492 20:14619505-14619527 AAGGAGGAAAGGAGGGAAGGAGG + Intronic
1170438069 20:16350542-16350564 AAGGTGGGGAGGAGGGAAGATGG + Intronic
1170463631 20:16602297-16602319 TAGTTGGAAAGGAGGAGAGATGG + Intergenic
1170859195 20:20086977-20086999 GAGGTGGGAAGGAGGGAAGATGG + Intronic
1171203039 20:23257097-23257119 CAGGTGGGAAGGTGGGAATAAGG - Intergenic
1171370913 20:24661460-24661482 TAGGAAGGAGGGAGGGAAGAGGG + Intronic
1171770708 20:29320266-29320288 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1171779097 20:29402529-29402551 GAGGGGGGAAGGTGGGAAGAGGG + Intergenic
1172350545 20:34235962-34235984 AAGGAGGGAGGGAGGGAAGAAGG + Intronic
1172360537 20:34309875-34309897 AAGGAGGTAGGGAGGGAAGGAGG + Intronic
1172898255 20:38315768-38315790 AAGGAAGGAAGGAGGGAAGAAGG - Intronic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173278417 20:41604748-41604770 AAAGAGGTAAGCAGGGAAGAAGG + Intronic
1173908087 20:46643188-46643210 TGGGTGGGAAGGGGGGAAGGGGG + Intronic
1174302565 20:49593122-49593144 AAAGTGGAAGGGAGGGAAGACGG - Intergenic
1174411692 20:50340669-50340691 TTTGTGGTGAGAAGGGAAGAAGG + Intergenic
1174627610 20:51928231-51928253 GAGGGAGAAAGGAGGGAAGAAGG + Intergenic
1174795847 20:53522041-53522063 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1174795850 20:53522049-53522071 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1174797399 20:53533737-53533759 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1174832699 20:53827727-53827749 AAGGAGGGAGGGAGGGAAGAGGG - Intergenic
1174926547 20:54766754-54766776 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1174926550 20:54766762-54766784 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1174926553 20:54766770-54766792 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1175209675 20:57344716-57344738 TATGTAGTAAGGATTGAAGAAGG + Intergenic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1175293654 20:57894577-57894599 GAGGAGGGAAGGAAGGAAGAGGG + Intergenic
1175422094 20:58840939-58840961 CAGGTGGAAAGGAGGTGAGAAGG + Intronic
1175658860 20:60794990-60795012 GAATTGGTAAGGAGGGAATATGG + Intergenic
1175717130 20:61262739-61262761 TGGGAGGTAAGGAGGTAAGGAGG - Intronic
1175742621 20:61430676-61430698 CAGGTAATAAGGAGGGAAGCAGG - Intronic
1175816207 20:61884482-61884504 CAGGAGGGAGGGAGGGAAGATGG + Intronic
1175901099 20:62360209-62360231 TGGGTGAGAAGGAAGGAAGACGG + Intronic
1176949722 21:15030726-15030748 TAGGTGGTAAGGAGGGAAGAAGG + Intronic
1177046960 21:16182934-16182956 TAGGAGGAAGGGAGGGAAAAAGG - Intergenic
1177430667 21:20988574-20988596 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1177957232 21:27613931-27613953 GAGGGTGGAAGGAGGGAAGAGGG - Intergenic
1178239004 21:30877402-30877424 AAGGTGGCAGGAAGGGAAGAAGG + Intergenic
1178669109 21:34575317-34575339 AAGGAGGAAAGGAGGGAAGTGGG - Intronic
1178762209 21:35413831-35413853 AAGAAGGGAAGGAGGGAAGAGGG + Intronic
1179232299 21:39515776-39515798 ATGATGGTAAGGAGGGATGATGG + Intergenic
1179388926 21:40969826-40969848 TAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1179388962 21:40970004-40970026 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1179793507 21:43768961-43768983 GATGTGGGAAGGAGGGAGGAGGG + Intergenic
1179832439 21:44005832-44005854 TGTGGGGTAAGGAGGGAGGAGGG - Intergenic
1180156115 21:45978014-45978036 GAGGGGGAAAGGAGGGAAGGGGG + Intergenic
1180156216 21:45978352-45978374 GAGGGGGAGAGGAGGGAAGAGGG + Intergenic
1180182362 21:46123686-46123708 TAGGTGGGTAGGTGGGTAGATGG + Intronic
1181615248 22:24049827-24049849 CAGGTGGAGAGGTGGGAAGATGG - Intronic
1181912877 22:26254410-26254432 AAGGAGGAAAGGAAGGAAGATGG + Intronic
1182234803 22:28866779-28866801 TAGGAGGGAAGGAAGGAAGGAGG + Intergenic
1183085827 22:35486405-35486427 GTGGAGGTAAGGAGGGGAGAGGG - Intergenic
1183109230 22:35636825-35636847 CAGCTGGGAGGGAGGGAAGAGGG - Intronic
1183209736 22:36443425-36443447 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1183390681 22:37544179-37544201 AAGGAGGAAAGGAGGAAAGAAGG + Intergenic
1183432509 22:37774303-37774325 TAGGAGGTAGGGCAGGAAGAGGG - Exonic
1183853982 22:40617159-40617181 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1183853985 22:40617167-40617189 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1184188134 22:42878064-42878086 AAGGTGCCAAGGAGGGAGGAGGG - Intronic
1184281920 22:43442285-43442307 TGGGTGGGGAGGTGGGAAGAAGG - Intronic
949883557 3:8678769-8678791 TAAGTGGCAGGGAGGGAAGAGGG - Intronic
950007632 3:9701705-9701727 CAGGTGGTATGGAGGGAGGGAGG + Intronic
950965674 3:17144138-17144160 CAGGGGCTGAGGAGGGAAGAAGG - Intergenic
951123092 3:18951381-18951403 CAGGTGCTAAGGAGAGGAGAAGG + Intergenic
951891603 3:27572872-27572894 TAGGAGGTAGAGAGGGAGGAAGG - Intergenic
951901853 3:27664860-27664882 AAGATGGTAAGGAGTCAAGATGG + Intergenic
952531460 3:34266450-34266472 TTGGGAGAAAGGAGGGAAGAAGG - Intergenic
952769966 3:36990669-36990691 TGGGTGATGGGGAGGGAAGAGGG + Exonic
953175739 3:40550533-40550555 AAGGAGGAAAGGAGGAAAGAAGG - Intronic
953546760 3:43869232-43869254 TAGGAGGCAGGGAGGGATGAAGG + Intergenic
954656124 3:52195293-52195315 AAGGAGGGAAGGAGGGAAAAGGG + Intergenic
954899675 3:54008151-54008173 TACGTGGTAAAGGGTGAAGATGG - Intergenic
955196911 3:56812933-56812955 TGGGAGGTAGGGAGGAAAGAAGG + Intronic
955629715 3:60960161-60960183 AGGGTGGGAAGAAGGGAAGAGGG - Intronic
956203920 3:66736664-66736686 GAGGCAGTAGGGAGGGAAGAGGG - Intergenic
956643673 3:71435969-71435991 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
956694491 3:71906924-71906946 TAGGGGGAAAGGGGGGAAGGAGG + Intergenic
956696204 3:71921355-71921377 TAAGGGGTCAGGAGGGAAGCAGG + Intergenic
956783705 3:72624803-72624825 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
957979849 3:87494586-87494608 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
959602243 3:108200442-108200464 TAGGTGGTAAGTGGTGATGAGGG + Intronic
959758660 3:109930089-109930111 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
960452224 3:117824810-117824832 TAGGTAGTGAGGAGCGAAAAAGG + Intergenic
960844619 3:121994368-121994390 TAGGTGGAAAGAAGTGAAGTGGG - Intronic
960891410 3:122452503-122452525 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
960891413 3:122452511-122452533 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
960891416 3:122452519-122452541 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
960891419 3:122452527-122452549 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
961002933 3:123386167-123386189 TAGGTGGACAGGAGGGCACAGGG + Intronic
961283494 3:125781718-125781740 TAGATGGTAAGGTGGGTGGATGG - Intergenic
961413136 3:126737713-126737735 CAGGTGGAGAGGAGGGAGGAAGG + Intronic
962079668 3:132124505-132124527 TAGAAGGAAAGGAGTGAAGAAGG - Intronic
962518998 3:136180743-136180765 GAGGAGGGAAGGAGGGAAGGAGG + Intronic
962672532 3:137723733-137723755 TAGGTGGGAAAGAAGGCAGATGG - Intergenic
962890229 3:139665357-139665379 TCTGTGCCAAGGAGGGAAGAAGG - Intronic
963121541 3:141780849-141780871 GAGTTGGAAAGGAGGGGAGAGGG + Intronic
963286857 3:143441959-143441981 TGGGTGGTCAGGTGGGTAGAAGG - Intronic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963622520 3:147629392-147629414 GAGGTGGTGAGGTGGGGAGATGG - Intergenic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
963929827 3:150991965-150991987 TGGTTGGGAAGGAGGGTAGATGG + Intergenic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
964394520 3:156231531-156231553 AAGGAGGGAAGAAGGGAAGAAGG - Intronic
964394522 3:156231539-156231561 AAGGAAGGAAGGAGGGAAGAAGG - Intronic
964416644 3:156454692-156454714 TAGGTGGCAAGCAGGGAGGGAGG + Intronic
964844615 3:161032013-161032035 GATGTGGTAAGGAGACAAGAAGG - Intronic
964903847 3:161693962-161693984 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
965083887 3:164069463-164069485 CAGGAGGGAAGGAGGGAAGGTGG + Intergenic
965203232 3:165687721-165687743 TAGAATGTAAGAAGGGAAGAAGG + Intergenic
965622452 3:170655144-170655166 TAGGTGGTGAGGACGGAGCAGGG - Intronic
965632705 3:170749652-170749674 GGGGTGGAAAGAAGGGAAGATGG - Intronic
966239647 3:177742278-177742300 GAGCTGCGAAGGAGGGAAGAGGG + Intergenic
966242036 3:177765611-177765633 AATGAGGAAAGGAGGGAAGAAGG + Intergenic
966311023 3:178594031-178594053 AAGGAGGGAGGGAGGGAAGAGGG - Intronic
966614691 3:181900753-181900775 AAGGTAGAAAGGAGGTAAGAGGG + Intergenic
967236899 3:187393789-187393811 ATGCTGGTAAGAAGGGAAGAAGG - Intergenic
967350704 3:188511125-188511147 TAGGAAGAAAGGAGGGAAGCAGG - Intronic
967726735 3:192869299-192869321 GAGGAGGGAAGGAGGGAAGGAGG + Intronic
967726737 3:192869307-192869329 AAGGAGGGAAGGAGGGAAAAAGG + Intronic
967789476 3:193531416-193531438 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
967808608 3:193736588-193736610 AAGGTGGTAAGAAGGGAAGCCGG + Intergenic
967821884 3:193846204-193846226 GAGGTGGTGAGGGGAGAAGATGG + Intergenic
968208822 3:196829292-196829314 AAGGGGGAAAGGAGGGAAGAAGG - Exonic
968366890 3:198192409-198192431 GAGGAGGGAAGGAGGGAAAAAGG - Intergenic
968423419 4:504368-504390 GAGCTGGAAAGGAGGGAAGTGGG + Intronic
968471518 4:784698-784720 TAGGTGGGAGGGAGAGCAGAGGG + Intergenic
969492542 4:7508218-7508240 AAGGGGGTGAGGAGGGATGAAGG + Intronic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970434690 4:16022104-16022126 AAGGAGGGAAGGAGGGAAGAAGG + Intronic
970801008 4:19973724-19973746 AAGGAAGGAAGGAGGGAAGAGGG + Intergenic
970914968 4:21321925-21321947 AAGGTGGGAAGGAGGGAGGGAGG + Intronic
971218087 4:24680559-24680581 AAGGAGGAAAGGAGGGAGGAGGG + Intergenic
971273084 4:25170100-25170122 TAGGTGGTGGGGAGTGGAGAGGG - Intronic
971284480 4:25274466-25274488 TAGGTGGTATGTTGGGGAGAGGG + Intronic
971289823 4:25327397-25327419 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
971289826 4:25327405-25327427 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
971289829 4:25327413-25327435 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
971420224 4:26467738-26467760 TAGGAAGGAAGGAAGGAAGAAGG + Intergenic
971665533 4:29478675-29478697 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
972353060 4:38255030-38255052 AAGGAAGAAAGGAGGGAAGAAGG + Intergenic
972619573 4:40733822-40733844 AAGGTGGGAAGGAGGGAAGGAGG + Intergenic
972625282 4:40791927-40791949 TAGCTAGTAAGTAGGGAAGCTGG + Intronic
973544391 4:51966197-51966219 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
973655620 4:53044616-53044638 AAGGAGGGAGGGAGGGAAGAAGG - Intronic
973738968 4:53901547-53901569 TAAGAGGGAAGGAAGGAAGAAGG + Intronic
974392531 4:61290684-61290706 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
974392534 4:61290692-61290714 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
974475600 4:62375175-62375197 ATGGTGGCTAGGAGGGAAGATGG + Intergenic
975631197 4:76404198-76404220 TGGGTGGGAAGGATGGAAGAAGG - Intronic
975923749 4:79424158-79424180 TAGCTGGAAAGGAGTGAACAAGG + Intergenic
975955341 4:79830534-79830556 AAGGAAGTAAGGAGGGAAGAGGG + Intergenic
976321869 4:83725505-83725527 GAGGGAGTAAGGAGGGAAGGGGG - Intergenic
976626675 4:87191757-87191779 TATGGGGGAAGGAGGGAAGGCGG - Intronic
977516278 4:98024164-98024186 AAGTTGGTAAGGAGCCAAGATGG - Intronic
978085961 4:104655035-104655057 AAGGAGGTAAGGAAGGAAAAAGG + Intergenic
978480974 4:109190395-109190417 GAGGAAGGAAGGAGGGAAGAAGG + Intronic
978728627 4:111999336-111999358 GAGGAGGGAAGGAGGGAAGGAGG + Intergenic
978767958 4:112423733-112423755 AAGTTGGTAAGGTGGGAAGTTGG - Intronic
979255303 4:118602018-118602040 AAGGAGGAAAGGAGGGAAAAAGG - Intergenic
979538448 4:121851412-121851434 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
979994316 4:127412148-127412170 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
979994319 4:127412156-127412178 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
980807148 4:137828332-137828354 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
980918368 4:139056091-139056113 CAGGTGGTAAGGATGGATGTTGG + Intronic
981060895 4:140424642-140424664 TAATTTATAAGGAGGGAAGAGGG - Intronic
981763727 4:148223128-148223150 TAGGTGGTAAGGTTGGAAAGTGG - Intronic
981800816 4:148653450-148653472 AAGGTAGGAAGGAGTGAAGATGG - Intergenic
982294123 4:153808915-153808937 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
982294126 4:153808923-153808945 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
982294129 4:153808931-153808953 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
982297423 4:153844070-153844092 TGGGTGGCATGGAAGGAAGAGGG + Intergenic
982413479 4:155105639-155105661 TAGCTTGTATGGAGGGTAGATGG + Intergenic
982558628 4:156900886-156900908 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
982861584 4:160457995-160458017 TAGGAGGTAAGAAAAGAAGATGG - Intergenic
983042017 4:162940667-162940689 TAGAAGGTAACAAGGGAAGATGG + Intergenic
983976218 4:173937225-173937247 CAGGAGGTAAGAAGGGAAAAAGG - Intergenic
984114429 4:175662238-175662260 GAGGTGGTATGCAGGCAAGAGGG - Intronic
984224993 4:177023792-177023814 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
984568410 4:181359576-181359598 TAGGTGGATAGAAGGGAGGAGGG + Intergenic
984634861 4:182099860-182099882 TATGAGGTAAAGAGGGAAGCAGG + Intergenic
985209825 4:187580871-187580893 GAGGAGGGAAGGAGGGAAGGAGG + Intergenic
985273548 4:188216612-188216634 AAGGGGGTAAGGAAGGAAGGAGG - Intergenic
985621347 5:957778-957800 TCGGTGGCAAGGATGGCAGAGGG - Intergenic
985932132 5:3067027-3067049 TGGTTTGTTAGGAGGGAAGATGG + Intergenic
986178692 5:5373672-5373694 TAGGTAATAGGGAGGGAAGGAGG - Intergenic
986294012 5:6422579-6422601 AAGGAGGGAAGGAAGGAAGAGGG + Intergenic
986313584 5:6571730-6571752 AGGGTGGGAAGGAGGGAAGGAGG + Intergenic
986917218 5:12635940-12635962 TATGTGGTAACAAGAGAAGAAGG + Intergenic
987734219 5:21818519-21818541 TCTGGGGGAAGGAGGGAAGAAGG - Intronic
987960173 5:24796941-24796963 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
987960176 5:24796949-24796971 CAGGGGGGAAGGAGGGAAGGAGG - Intergenic
988031082 5:25763221-25763243 CAGGTGGTGAAGAGGGAAGGAGG + Intergenic
989122877 5:38021669-38021691 AAGGAGGGAAGGAAGGAAGAAGG - Intergenic
989403367 5:41033334-41033356 TGGGTGGTAGGGAGGAAAAATGG - Intronic
990688715 5:58337849-58337871 TAGGTGGGAAGATGGGAGGAAGG + Intergenic
991440520 5:66642923-66642945 TAGCTGGAAAGCTGGGAAGAAGG + Intronic
992614320 5:78534612-78534634 GACATGGGAAGGAGGGAAGATGG - Intronic
993491470 5:88556629-88556651 AAGGTGGGGCGGAGGGAAGAAGG - Intergenic
993783916 5:92105047-92105069 TAGCTGGTGAGGAGGCAAAAAGG + Intergenic
993972957 5:94442398-94442420 TGAGTGGTAAAGAGAGAAGAAGG + Intronic
994084515 5:95743674-95743696 AGGGAGGGAAGGAGGGAAGAGGG - Intronic
994427051 5:99603206-99603228 CATGTGGTAAGGAAGGCAGATGG + Intergenic
994596400 5:101843227-101843249 AAGGAGGAAAGGAGGGAAGTAGG + Intergenic
994918983 5:106017693-106017715 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
994918986 5:106017701-106017723 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
995131767 5:108638079-108638101 TAGGGGGGAAGGAGGGAACATGG + Intergenic
995277164 5:110289961-110289983 TATGAGGGAAGGAGAGAAGAAGG + Intronic
995453004 5:112323199-112323221 TAACTGGAAAGGAGGGAAGAGGG + Intronic
995624000 5:114056761-114056783 AAGGGGGGAAGGATGGAAGACGG - Intergenic
996564155 5:124862445-124862467 TGGGTTGTAGGGAGGAAAGAAGG + Intergenic
997174514 5:131760855-131760877 CAGGAGGGAAAGAGGGAAGAAGG + Intronic
997576331 5:134980381-134980403 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
998469221 5:142370355-142370377 AGGGAGGTAAGGAGGGAAGTGGG - Intergenic
998499654 5:142621379-142621401 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
998569919 5:143247731-143247753 TAGGTGGTCGGGTGGGCAGATGG + Intergenic
998638904 5:143987441-143987463 AAGGTGGGAAGGTGGGAAGGTGG - Intergenic
999090450 5:148931674-148931696 TAGGTGGGAAAGAGGGAAGGAGG - Intronic
1000115294 5:158148652-158148674 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1000115299 5:158148668-158148690 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1000115304 5:158148684-158148706 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1000115309 5:158148700-158148722 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1000313560 5:160067831-160067853 TAAGTGTTAAGGAAGGAAGGTGG + Intronic
1000381968 5:160637285-160637307 TAGGTGGGTAGGAGGGTGGATGG - Intronic
1000428054 5:161115986-161116008 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1000676680 5:164130337-164130359 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1000849098 5:166318007-166318029 GAGTTGGAAAGGAGGGGAGAGGG - Intergenic
1001320458 5:170676227-170676249 CAGGTGGGAGGGAGGGAGGAAGG + Intronic
1001468477 5:171990123-171990145 GAAATGGGAAGGAGGGAAGAAGG + Intronic
1001640720 5:173242422-173242444 AAGGTGGCAAAGTGGGAAGATGG + Intergenic
1001774787 5:174320734-174320756 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1001774832 5:174320864-174320886 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1001913112 5:175537277-175537299 GAGGTGTGAAGGAGGGCAGAGGG - Intergenic
1002246521 5:177889469-177889491 TTGGTGGGGAGGAGGCAAGAAGG + Intergenic
1002410190 5:179068673-179068695 TTGGTGGTAAAGACGGAAGTTGG + Intronic
1003578710 6:7320168-7320190 TAGGTGCCAAGCAGAGAAGAAGG - Intronic
1004002014 6:11604565-11604587 TAGCTGGTAAAGTGGGAAGGAGG + Intergenic
1004075986 6:12344654-12344676 GAGGTGGCCAGGAGGGTAGACGG - Intergenic
1004129010 6:12901431-12901453 TTGGAGGAAAGGAGGAAAGAGGG + Intronic
1005441892 6:25878943-25878965 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
1005598400 6:27401625-27401647 AAGGAGGGAAGGAGGGAAGAAGG - Exonic
1005883392 6:30076232-30076254 TAATAGGTAAGGAAGGAAGATGG - Intergenic
1005939305 6:30548752-30548774 TAGGAGGAAGGGAGGGAAGGAGG + Intronic
1006606979 6:35264908-35264930 GAGGCAGTAAGGAGGAAAGAGGG + Intronic
1006638661 6:35477406-35477428 CAGGTGGAAGGTAGGGAAGAGGG - Intronic
1007019735 6:38507487-38507509 TGGATGGTATGGAGAGAAGAGGG - Intronic
1007407512 6:41643527-41643549 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1007436916 6:41820361-41820383 GTGGTGGTAGGGAGGGAAGCTGG - Intronic
1007582289 6:42966706-42966728 TGGGTGGTGAGGAAGGGAGAAGG - Intronic
1007723638 6:43900958-43900980 TAGGTGGGAAGGAGGCAGGTAGG + Intergenic
1007741031 6:44009597-44009619 GAGGTAGGAAGGAGGGAGGAGGG + Intergenic
1007741036 6:44009612-44009634 GAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1008327419 6:50200235-50200257 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1008457743 6:51730925-51730947 GAGGTTGAAGGGAGGGAAGAGGG + Intronic
1008664845 6:53706003-53706025 AAGGAGGAAGGGAGGGAAGAAGG + Intergenic
1008922563 6:56858070-56858092 TAGGTAGTAAGTGTGGAAGAGGG + Intronic
1009828887 6:68904044-68904066 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1009828890 6:68904052-68904074 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1010507273 6:76675701-76675723 AAGGTGGGAAGGAAGGAAGGAGG - Intergenic
1011270806 6:85578100-85578122 TAGGAGAAAAGGAGGCAAGAGGG + Intronic
1011601442 6:89064090-89064112 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1011682021 6:89792507-89792529 TGGGGGGTAAAGAGGGAGGAGGG + Intronic
1012817968 6:104048490-104048512 TCAGTAGTAAGGAGGAAAGATGG - Intergenic
1013110755 6:107063015-107063037 TTTGTGGTAAGGAGAGAAGTTGG - Intergenic
1013536908 6:111071377-111071399 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1014378102 6:120702649-120702671 AAGGAAGGAAGGAGGGAAGAAGG + Intergenic
1014378113 6:120702699-120702721 AAGGAAGGAAGGAGGGAAGAAGG + Intergenic
1014378119 6:120702726-120702748 AAGGAAGGAAGGAGGGAAGAAGG + Intergenic
1014378135 6:120702799-120702821 AAGGAAGGAAGGAGGGAAGAAGG + Intergenic
1014378140 6:120702818-120702840 AAGGAAGGAAGGAGGGAAGAAGG + Intergenic
1015085574 6:129287088-129287110 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
1015171384 6:130258657-130258679 TGGGTGATAAGGAGGTGAGAAGG - Intronic
1015383906 6:132600774-132600796 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1015383953 6:132600922-132600944 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1015383962 6:132600954-132600976 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1015383983 6:132601014-132601036 AAGGGGGGAAGGAGGGAAGGAGG + Intergenic
1015384006 6:132601090-132601112 AGGGAGGGAAGGAGGGAAGAAGG + Intergenic
1015709130 6:136120542-136120564 CAGGTGGGAAGAAGGAAAGAAGG + Intronic
1016260447 6:142163291-142163313 TAGGTAGTAGGGAGGAAAAAAGG + Intronic
1016480090 6:144471213-144471235 AGGGTGGGAAGGAGGGAGGAGGG + Intronic
1017225018 6:152010936-152010958 TAGGAAGAAAGGAAGGAAGAAGG - Intronic
1017260366 6:152378738-152378760 GAGGTGGGAAGGAGGGCAGGGGG - Intronic
1017297228 6:152812049-152812071 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1017929302 6:158938494-158938516 CAGGTGAAAAGGAGGGAGGAAGG + Intergenic
1018302979 6:162423375-162423397 AAGGTGGAAGGGAGGGAGGAAGG - Intronic
1018646598 6:165954609-165954631 CAGGTGGTGAGGAGGGAGGACGG - Intronic
1018650415 6:165987820-165987842 CAGATGGAAAGGAGGGAAGGAGG - Intergenic
1019040040 6:169096157-169096179 TGGGGGGTGAGGAGGGAGGAGGG - Intergenic
1019059047 6:169242688-169242710 GTGGTGGGAAGGTGGGAAGATGG - Intronic
1019059055 6:169242713-169242735 AAGGTGGGAAGGTGGGAAGGTGG - Intronic
1019059073 6:169242762-169242784 AAGGTGGGAAGATGGGAAGATGG - Intronic
1019059075 6:169242770-169242792 GTGGTGGGAAGGTGGGAAGATGG - Intronic
1019059092 6:169242820-169242842 AAGGTGGGAAGGTGGGAAGGTGG - Intronic
1019059103 6:169242853-169242875 AAGGTGGGAAGGTGGGAAGGTGG - Intronic
1019059120 6:169242903-169242925 GTGGTGGGAAGGTGGGAAGATGG - Intronic
1019059128 6:169242928-169242950 AAGGTGGGAAGGTGGGAAGGTGG - Intronic
1019059131 6:169242936-169242958 AAGGTGGGAAGGTGGGAAGGTGG - Intronic
1019335165 7:479226-479248 GAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1019335180 7:479268-479290 GAGGAGGGAAGGAGGGAAGAGGG + Intergenic
1019494907 7:1333325-1333347 GAGGAGGTGAGGAGGGAAGAGGG - Intergenic
1019783523 7:2958876-2958898 GAGATGGGGAGGAGGGAAGATGG + Intronic
1019804957 7:3116972-3116994 TTGGTGGTGAGGAGGGGAGTGGG + Intergenic
1020409768 7:7878272-7878294 TATGTGGTAAGGAGAGCAAATGG - Exonic
1020469135 7:8515919-8515941 GAGGTGGTAAGAACAGAAGAAGG - Intronic
1020677502 7:11198673-11198695 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1020706631 7:11552158-11552180 GAGGGTGTAAGGTGGGAAGAGGG + Intronic
1021112450 7:16710656-16710678 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1021412712 7:20346373-20346395 TAGGAGATAAGGAGAAAAGAGGG + Intronic
1021944482 7:25713116-25713138 GAGGAGGTGAGTAGGGAAGAAGG + Intergenic
1021995857 7:26177595-26177617 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
1022109245 7:27218209-27218231 TGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1022278740 7:28883334-28883356 AAGGAAGGAAGGAGGGAAGAAGG - Intergenic
1023397401 7:39763873-39763895 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1023689693 7:42773068-42773090 TGGTTGGTAAGAAAGGAAGAAGG - Intergenic
1023848148 7:44134821-44134843 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1023848151 7:44134829-44134851 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1024110996 7:46146122-46146144 GAGGTGGGGAGGAGGGGAGAGGG - Intergenic
1024257572 7:47550009-47550031 TGGGTGGGAGGGATGGAAGAGGG - Intronic
1024386311 7:48755786-48755808 AAGGTTGGAAGGATGGAAGATGG - Intergenic
1025117193 7:56268428-56268450 GAGGTGGGAAGGAGGAAAGGAGG - Intergenic
1026312159 7:69195825-69195847 AAGGTGGGAGGGTGGGAAGAGGG + Intergenic
1026871074 7:73852214-73852236 AAGGCGGGAAGGAGGGAAGCAGG - Intergenic
1026874892 7:73873562-73873584 TGGGGGGTGAGGAGGGAAGCAGG + Intergenic
1027152978 7:75745946-75745968 TAGGTGGTTAAGAGACAAGATGG + Intergenic
1027416879 7:77983400-77983422 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1027456750 7:78401891-78401913 TATCTGGGAAGGAGGGAAGAAGG - Intronic
1028636783 7:92997986-92998008 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1029088266 7:98028297-98028319 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1029135395 7:98366876-98366898 AAGGAAGAAAGGAGGGAAGAAGG - Intronic
1029184478 7:98728769-98728791 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1030898544 7:115092650-115092672 TAGGTAGTTAGGGGGGAAAAAGG - Intergenic
1031260562 7:119513838-119513860 AAGGTGGGAAGGAAGGAAGGAGG + Intergenic
1031448103 7:121879824-121879846 AAGGAGGAAGGGAGGGAAGAAGG - Intronic
1031646519 7:124232513-124232535 TATGTGCTAAGGAAGGAAGCAGG - Intergenic
1031646939 7:124237533-124237555 TATGTGCTAAGGAAGGAAGCAGG - Intergenic
1031660860 7:124422423-124422445 TGGGTGGTAAGCGGGAAAGAAGG + Intergenic
1031866154 7:127040044-127040066 AGGGTGGGGAGGAGGGAAGAAGG + Intronic
1032172587 7:129597729-129597751 TAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1032402620 7:131634447-131634469 AAGGAGGGAAGGAAGGAAGAAGG - Intergenic
1032790937 7:135242022-135242044 CAGGAAGTAAGGAGGGAAGAAGG + Intronic
1033025317 7:137766625-137766647 TGAGTGGGAAGGAGGGAATAAGG - Intronic
1033163976 7:139022842-139022864 TAGGTTGTGAGGTAGGAAGAAGG + Intergenic
1033164160 7:139024979-139025001 TAGGTGGAGAGCAGGGAGGAAGG + Intergenic
1033877341 7:145838586-145838608 GAGGGTGTAAGGTGGGAAGAGGG + Intergenic
1034995124 7:155572135-155572157 AAGGAGGGAAGGAGGAAAGATGG + Intergenic
1035326276 7:158068030-158068052 TATGGGGAAAGGAGGGAGGAAGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035524091 8:298740-298762 CCGGTGGGAAGGAAGGAAGAGGG - Intergenic
1035776256 8:2191160-2191182 GAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1035931702 8:3786792-3786814 CAGGTGGTAGAGAGAGAAGAAGG + Intronic
1035992755 8:4510744-4510766 GAGGAGGGAAGGAGGGAAGAGGG - Intronic
1036217992 8:6896817-6896839 TAGGCGGTAAGGAGGAAATGAGG - Intergenic
1036236837 8:7046179-7046201 GAGGTCGTTAGGAGGGAAGTTGG + Intergenic
1036495754 8:9268565-9268587 AAGGGGGGAAGGAGGGAAGGGGG + Intergenic
1036663048 8:10720858-10720880 GAGGGGGGAAGGAGGGAGGAAGG - Intergenic
1036983678 8:13501034-13501056 TATGTGGGAAGAAGGGATGAAGG - Intronic
1037268391 8:17095718-17095740 AAGGAGGAAAGGAGGGAAAAAGG - Intronic
1037697858 8:21243062-21243084 AAGGCAGTAAGGAGGGAAAAAGG - Intergenic
1037774405 8:21823398-21823420 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1038415634 8:27393187-27393209 GAGGTGGGCAGGAGTGAAGATGG - Intronic
1038784332 8:30597273-30597295 TAGGAGCAAAGAAGGGAAGAAGG + Intronic
1038899856 8:31830362-31830384 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1038899859 8:31830370-31830392 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1039304470 8:36246745-36246767 TAGATGTTAGGGAGGGAGGAGGG - Intergenic
1039762204 8:40589948-40589970 AGGGAGGGAAGGAGGGAAGAAGG - Intronic
1039765991 8:40628618-40628640 TGTGTGGAAAGGAGGGAAGGAGG + Intronic
1039774358 8:40720873-40720895 AAGGTGGGAGGGAGGGAAGGGGG + Intronic
1039807483 8:41013267-41013289 AAGGTGGTTGGGTGGGAAGAGGG - Intergenic
1040869278 8:52083622-52083644 AAGTTGGTAGGGAGGGATGATGG + Intergenic
1040879380 8:52189116-52189138 TTGGGGGCAAGGAGGGGAGATGG - Intronic
1040935643 8:52779051-52779073 GAGGTGGGAGGGTGGGAAGAGGG - Intergenic
1041537421 8:58942788-58942810 TACTTGGTGAGGAGGGAATAGGG - Intronic
1041719588 8:60964138-60964160 GAGGGGGTGGGGAGGGAAGAAGG + Intergenic
1041802323 8:61813504-61813526 AAGGAGGGAAGGAGGGAAGAAGG - Intergenic
1042089644 8:65144841-65144863 AAGGGGGCAAGGAAGGAAGAAGG - Intergenic
1042959071 8:74283531-74283553 AAGGTGAGAAGGAGGAAAGATGG + Intronic
1043560273 8:81485135-81485157 AAGGTGGGAAGGTGGGAAGGTGG - Intergenic
1044009145 8:86970597-86970619 CAGGTGGGAGGGAGAGAAGAGGG - Intronic
1044443564 8:92247776-92247798 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1044450374 8:92329335-92329357 ATGGTGGTAAGGAGGACAGATGG - Intergenic
1044975349 8:97659266-97659288 TATGGGGGAAGGAAGGAAGAGGG - Intronic
1044994703 8:97828205-97828227 GGGGTGGTATGGAGGGATGATGG + Intronic
1045357924 8:101405743-101405765 AAGGAGTGAAGGAGGGAAGAGGG - Intergenic
1045487120 8:102640410-102640432 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1045758029 8:105568972-105568994 TAGGTGGGGAGGGGGGAATAGGG - Intronic
1045981014 8:108187344-108187366 CAGGTGGTCAGAAGGGAAGATGG - Intergenic
1046605341 8:116365508-116365530 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1046605349 8:116365535-116365557 AAGGAGGAAGGGAGGGAAGAAGG + Intergenic
1046754674 8:117961121-117961143 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1047189753 8:122667350-122667372 CAGGTGGCCAGGTGGGAAGAGGG - Intergenic
1047240787 8:123086190-123086212 GGTGTGGTAAGGAGGGAGGAGGG - Intronic
1047292063 8:123540258-123540280 GAGGTGCAAAGGAGGGAAGGGGG - Intronic
1047803700 8:128336369-128336391 AAAGTGGTAAAGAGGGGAGATGG + Intergenic
1048125818 8:131634912-131634934 TGGGAGGTAGGGAGGCAAGAGGG - Intergenic
1048161859 8:132028596-132028618 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1048432420 8:134382577-134382599 CAAGTGGCAAGGAGGGAAGAGGG - Intergenic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1049897164 9:118838-118860 GAGGTGGGAAGGAAGGTAGAAGG - Intergenic
1050340955 9:4638176-4638198 TAGGAAGACAGGAGGGAAGATGG + Intronic
1050369912 9:4910144-4910166 TAGGAGAGAAGGAAGGAAGAAGG + Intergenic
1050461530 9:5881474-5881496 TTGATGCTAAGCAGGGAAGAGGG + Intergenic
1050571125 9:6940046-6940068 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1051408512 9:16764898-16764920 AAGGAGGGAAGGAGGGAGGAGGG + Intronic
1051534999 9:18147383-18147405 TAGGTGGTATGGGGACAAGATGG + Intergenic
1052436946 9:28442536-28442558 TAGTTGGTAAGTACTGAAGAAGG - Intronic
1052703668 9:31968205-31968227 GAGGTGGTAGGGCGGGAGGAGGG + Intergenic
1053740267 9:41129103-41129125 GAGGTGGGAAGGAAGGTAGAAGG - Intergenic
1054443229 9:65285096-65285118 GAGGTGGGAAGGAAGGTAGAAGG - Exonic
1054487051 9:65736405-65736427 GAGGTGGGAAGGAAGGTAGAAGG + Intergenic
1054688082 9:68302210-68302232 GAGGTGGGAAGGAAGGTAGAAGG + Intergenic
1054998483 9:71421211-71421233 GAGGTGGGAAGGAAGGAAGGGGG + Intronic
1055018504 9:71644852-71644874 AAGGGACTAAGGAGGGAAGAAGG - Intergenic
1055443897 9:76363774-76363796 TAAATGGTAAGGAGGGGAGGAGG + Intergenic
1055444012 9:76364900-76364922 TAAATGGTAAGGAGGGGAGGAGG - Intergenic
1055595085 9:77857641-77857663 AAGGGGGGAAGGAGGGAAGGAGG + Intronic
1055730307 9:79273926-79273948 AAGGAGGTAAGGAGGGAGGGAGG + Intergenic
1055819316 9:80242802-80242824 AAGGAGGTAGGGAGGGAGGAAGG - Intergenic
1055822067 9:80277880-80277902 TAGAAGGGAAGGAGGGAAGGAGG - Intergenic
1056322024 9:85444276-85444298 AAAGAGGTATGGAGGGAAGAAGG - Intergenic
1056965190 9:91159467-91159489 GAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1057810521 9:98253656-98253678 TAGGTGGCAAGCAGACAAGAGGG - Intronic
1058007882 9:99938827-99938849 TAAGAGGGAGGGAGGGAAGAAGG + Intronic
1058378205 9:104349496-104349518 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1058565239 9:106277087-106277109 TAGGAAGGAAGGAAGGAAGAAGG - Intergenic
1059095283 9:111406796-111406818 TAGGAGGTGAGGTGGGAGGATGG + Intronic
1059354288 9:113687278-113687300 TAGGCAGAGAGGAGGGAAGAGGG + Intergenic
1059491818 9:114674216-114674238 TGGGTGGACAGGAGGGAAGAAGG - Intergenic
1059819051 9:117951370-117951392 TAGGAGGGAAGGATTGAAGAAGG + Intergenic
1060188572 9:121578358-121578380 TAGGGGGAGAGGAGGGAAGAGGG - Intronic
1060481459 9:124018776-124018798 GAGGGGGTAGGGACGGAAGATGG - Intronic
1060599745 9:124869725-124869747 GAGGAGGCAAGGAGGGAAGAGGG - Intronic
1060675880 9:125514154-125514176 TAGGTGAAGAAGAGGGAAGAGGG - Intronic
1060694640 9:125697821-125697843 TTGGTGGTAAGATGGTAAGATGG - Intronic
1060899478 9:127245046-127245068 TTAGTGATAAAGAGGGAAGACGG - Intronic
1061246145 9:129402117-129402139 GAGGTGGGGAGGAGGGAGGAGGG - Intergenic
1061279031 9:129586569-129586591 TAGGTGCTCAGGAAGGAAGGAGG + Intergenic
1061448418 9:130655277-130655299 CAGGTGGGAAGGAGTGAAGCGGG + Intergenic
1061664113 9:132150338-132150360 CAGGTGGGAAGGAGGGTAGAAGG + Intergenic
1062089718 9:134669129-134669151 TAGGTGGAAGGGAGGGTGGATGG - Intronic
1062252407 9:135604948-135604970 AAGGAGGAAAGGAGGGAAGCAGG + Intergenic
1062328242 9:136023050-136023072 GAGGGAGGAAGGAGGGAAGAGGG + Intronic
1062328254 9:136023080-136023102 AGGGAGGGAAGGAGGGAAGAGGG + Intronic
1062449206 9:136608444-136608466 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1062751247 9:138255253-138255275 GAGGAGGGAAGGAGGGAAAAAGG - Intergenic
1185680008 X:1880799-1880821 GAGGGGGTAGGGAGGGAAGGAGG + Intergenic
1185680027 X:1880946-1880968 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1185700463 X:2227549-2227571 AAGGGAGAAAGGAGGGAAGAAGG + Intronic
1185765674 X:2723999-2724021 AAGGAAGGAAGGAGGGAAGAAGG + Intronic
1186206359 X:7204823-7204845 AAGGAGGGGAGGAGGGAAGAAGG - Intergenic
1186239897 X:7555010-7555032 GAGGTTGGAAGGAGGGATGATGG + Intergenic
1186240017 X:7555514-7555536 AAGGAGGGAAGGAGGGAGGATGG + Intergenic
1186376413 X:9006799-9006821 GAGGTGGGATGGAGGGAAGTGGG - Intergenic
1186380175 X:9049508-9049530 AAGGTGATGAAGAGGGAAGATGG - Intronic
1186406994 X:9313050-9313072 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1186490769 X:9970437-9970459 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1186490772 X:9970445-9970467 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1186688953 X:11954575-11954597 TAGGAAGTAAGGAGGGAAAAAGG + Intergenic
1186752920 X:12640321-12640343 AAGGTAGTAAGGAGAGAAGGGGG + Intronic
1187068172 X:15861451-15861473 GGGGAGGGAAGGAGGGAAGAAGG - Intergenic
1187149448 X:16668615-16668637 AAGGAGGGAAGGAAGGAAGAAGG + Intronic
1187485924 X:19703283-19703305 TTGGTGGTGAGGAGGGATAAAGG + Intronic
1189238437 X:39506991-39507013 GAGCTGATAATGAGGGAAGAGGG + Intergenic
1189373495 X:40448347-40448369 AAGGTGGTATGGAGGAAAGATGG - Intergenic
1189588592 X:42487912-42487934 AAGGAGCTAAGGAGAGAAGAGGG - Intergenic
1189675505 X:43456877-43456899 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1191870715 X:65742724-65742746 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1192099910 X:68253476-68253498 TAGATGGTTAGCAGGGGAGATGG - Intronic
1192105821 X:68315282-68315304 AAGGAGGTAGGGAGGGAGGAAGG + Intronic
1192183153 X:68928929-68928951 CAGGAGGAAAGGAGGGAGGAAGG + Intergenic
1193239102 X:79144901-79144923 AAGGAGGGAAGGAAGGAAGAAGG - Intergenic
1193824416 X:86205465-86205487 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1193824419 X:86205473-86205495 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1194139111 X:90186774-90186796 TAGGTGGCAAGAATGGAAGGAGG - Intergenic
1194387608 X:93276658-93276680 TAGGTGGTAAAAAACGAAGAAGG + Intergenic
1194982545 X:100454999-100455021 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1194982555 X:100455031-100455053 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1194982560 X:100455047-100455069 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1195375425 X:104222795-104222817 TTAGTAGTAAAGAGGGAAGAAGG + Intergenic
1195505624 X:105653498-105653520 AAGGAGGAAGGGAGGGAAGAAGG - Intronic
1195926580 X:110031758-110031780 TAGGGGGAAAGGAGGGATTAGGG - Intronic
1196109070 X:111926851-111926873 AAGGTGGTCAGGTGGGATGATGG + Intronic
1196467675 X:115990018-115990040 TAGCTGGTAGGGAGGTAAGCAGG + Intergenic
1197207413 X:123801696-123801718 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1198133785 X:133726662-133726684 CAGGTGGGAAGAAGGGGAGAAGG - Intronic
1198416660 X:136427029-136427051 TAGTTGCTAATGAGGGAGGAAGG + Intergenic
1198421422 X:136473256-136473278 TAGGTGGGAAGGAGGGTGGGAGG + Intergenic
1198473316 X:136970907-136970929 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1198706177 X:139450838-139450860 AAGGAGGGAAGGAGGAAAGACGG + Intergenic
1199046580 X:143181255-143181277 AAGGAGGGAAGGAGGGAAGAAGG + Intergenic
1199411541 X:147529313-147529335 CTGGTGGGAAGGAGGGTAGAAGG - Intergenic
1200413990 Y:2889336-2889358 AAGGAGGGACGGAGGGAAGAAGG - Intronic
1200484852 Y:3755743-3755765 TAGGTGGCAAGAATGGAAGGAGG - Intergenic
1200807028 Y:7443561-7443583 GAGGTGGGAGGGAGGGAGGAAGG - Intergenic
1200881738 Y:8220485-8220507 AGGGAGGGAAGGAGGGAAGAAGG - Intergenic
1201458872 Y:14201076-14201098 GAGGTTGTAAGGAGGGATGATGG + Intergenic
1201515205 Y:14812962-14812984 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
1201744889 Y:17361127-17361149 TGGGTGGTGAGGCAGGAAGAAGG - Intergenic
1202193758 Y:22273888-22273910 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1202372609 Y:24208943-24208965 TACCTGGTAGGGAGGGAAGGGGG - Intergenic
1202498175 Y:25461177-25461199 TACCTGGTAGGGAGGGAAGGGGG + Intergenic