ID: 1176952668

View in Genome Browser
Species Human (GRCh38)
Location 21:15064961-15064983
Sequence CGCCGCCGCCTCCCGAGTTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1484
Summary {0: 1, 1: 1, 2: 2, 3: 118, 4: 1362}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176952661_1176952668 -5 Left 1176952661 21:15064943-15064965 CCTCGCCGCCGCCTCCTCCGCCG 0: 1
1: 6
2: 141
3: 465
4: 1595
Right 1176952668 21:15064961-15064983 CGCCGCCGCCTCCCGAGTTCGGG 0: 1
1: 1
2: 2
3: 118
4: 1362
1176952662_1176952668 -10 Left 1176952662 21:15064948-15064970 CCGCCGCCTCCTCCGCCGCCGCC 0: 8
1: 64
2: 1376
3: 2477
4: 8374
Right 1176952668 21:15064961-15064983 CGCCGCCGCCTCCCGAGTTCGGG 0: 1
1: 1
2: 2
3: 118
4: 1362
1176952658_1176952668 11 Left 1176952658 21:15064927-15064949 CCGGGTCGTCCCTGCGCCTCGCC 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1176952668 21:15064961-15064983 CGCCGCCGCCTCCCGAGTTCGGG 0: 1
1: 1
2: 2
3: 118
4: 1362
1176952660_1176952668 1 Left 1176952660 21:15064937-15064959 CCTGCGCCTCGCCGCCGCCTCCT 0: 1
1: 1
2: 5
3: 82
4: 610
Right 1176952668 21:15064961-15064983 CGCCGCCGCCTCCCGAGTTCGGG 0: 1
1: 1
2: 2
3: 118
4: 1362
1176952659_1176952668 2 Left 1176952659 21:15064936-15064958 CCCTGCGCCTCGCCGCCGCCTCC 0: 1
1: 0
2: 5
3: 62
4: 500
Right 1176952668 21:15064961-15064983 CGCCGCCGCCTCCCGAGTTCGGG 0: 1
1: 1
2: 2
3: 118
4: 1362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176952668 Original CRISPR CGCCGCCGCCTCCCGAGTTC GGG Exonic
900255134 1:1693895-1693917 AACCTCCGCCTCCCGGGTTCAGG - Intronic
900263877 1:1747161-1747183 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
900360373 1:2285644-2285666 AACCTCCGCCTCCCGGGTTCAGG + Intronic
901073280 1:6534883-6534905 AACCTCCACCTCCCGAGTTCAGG + Intronic
901261178 1:7872184-7872206 TGCCTCAGCCTCCCGAGTACTGG - Intergenic
901396120 1:8983026-8983048 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
901489453 1:9589174-9589196 CGCCGCCGCCCCCCGAGACCGGG + Intronic
901576262 1:10203379-10203401 AACGTCCGCCTCCCGAGTTCAGG - Intergenic
901653799 1:10757704-10757726 AACCTCCGCCTCCCGGGTTCAGG - Intronic
902041570 1:13496419-13496441 CGCCTCAGCCTCCCAAGTGCTGG + Intronic
902222048 1:14972594-14972616 CAACCCTGCCTCCCGAGTTCCGG + Intronic
902290983 1:15434642-15434664 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
902307240 1:15550949-15550971 AACCTCCGCCTCCCGGGTTCAGG + Intronic
902313625 1:15600892-15600914 CGCCTCGGCCTCCCAAGTGCTGG + Intergenic
902321794 1:15672963-15672985 CACCTCCACCTCCCGGGTTCAGG + Intergenic
902506465 1:16941648-16941670 CAGCTCCGCCTCCCGGGTTCAGG - Intronic
902591640 1:17479229-17479251 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
902932593 1:19741985-19742007 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
902989411 1:20175989-20176011 AACCTCCGCCTCCCGGGTTCAGG + Intronic
903153286 1:21428209-21428231 CTCCGCCGCCGCCCGCGCTCCGG - Intergenic
903270048 1:22182470-22182492 AACCTCCGCCTCCCCAGTTCAGG - Intergenic
903593509 1:24476141-24476163 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
903697715 1:25220569-25220591 AACCTCCGCCTCCCGGGTTCTGG - Intergenic
903864353 1:26387523-26387545 CGCCTCGGCCTCCCAAGTGCTGG + Intergenic
903875863 1:26472677-26472699 CGCCGCCGCCTCCCTGGTGCAGG + Intronic
903883792 1:26529856-26529878 CTGCGCCGCCTCCCGGGTCCTGG - Intronic
903898292 1:26623226-26623248 CGCCTCGGCCTCCCAAGTGCTGG + Intergenic
903989131 1:27253088-27253110 AACCTCCGCCTCCCGGGTTCAGG + Intronic
904129386 1:28264235-28264257 AACCTCCGCCTCCTGAGTTCAGG - Intronic
904144415 1:28378419-28378441 AACCTCCGCCTCCCGGGTTCAGG - Intronic
904160837 1:28520963-28520985 CGCCTCAGCCTCCCTAGTGCTGG - Intronic
904182037 1:28672851-28672873 TGCCTCAGCCTCCCGAGTACTGG + Intronic
904205695 1:28853821-28853843 AGCCTCTGCCTCCCGGGTTCAGG + Intronic
904712999 1:32445143-32445165 CGCCGCCCCCTCCAGAGTCATGG - Intergenic
904838040 1:33351701-33351723 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
904949344 1:34223718-34223740 CGCCTCAGCCTCCCAAGTGCTGG + Intergenic
905412999 1:37784933-37784955 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
905420080 1:37836046-37836068 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
905504434 1:38465961-38465983 AACCTCCGCCTCCCGAGTTCAGG + Intergenic
906259072 1:44372622-44372644 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
906331361 1:44887814-44887836 AACCTCTGCCTCCCGAGTTCAGG - Intronic
906373380 1:45273624-45273646 AGCCTCTGCCTCCTGAGTTCAGG - Intronic
906408139 1:45558308-45558330 AACCTCCGCCTCCCGGGTTCAGG + Intronic
906445023 1:45888923-45888945 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
907014485 1:50998665-50998687 CGCCTCGGCCTCCCAAGTGCTGG - Intergenic
907126933 1:52058681-52058703 AACCTCCGCCTCCCGGGTTCAGG + Intronic
907143254 1:52208613-52208635 AACCTCTGCCTCCCGAGTTCAGG + Intronic
907365423 1:53955376-53955398 AGCCTCCGCCTCCCAGGTTCAGG + Intronic
907450009 1:54540126-54540148 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
907501060 1:54881066-54881088 AGCCTCCGCCTCCCAGGTTCCGG - Intronic
908141819 1:61192619-61192641 AACCTCCGCCTCCCCAGTTCAGG - Intronic
908750851 1:67421837-67421859 TGCCTCAGCCTCCCGAGTACTGG - Intronic
908836813 1:68236550-68236572 CGCCTCAGCCTCCCGATTACAGG - Intergenic
908849113 1:68356418-68356440 CGCCTCGGCCTCCCAAGTGCTGG - Intergenic
909013423 1:70358450-70358472 CGCCTCAGCCTCCCAAGTGCTGG + Intronic
909266645 1:73567735-73567757 AGCCTCTGCCTCCCGGGTTCAGG - Intergenic
910685022 1:89907271-89907293 AACCTCCGCCTCCCGGGTTCAGG + Intronic
910807610 1:91204239-91204261 AACCTCGGCCTCCCGAGTTCAGG - Intergenic
910813105 1:91257827-91257849 AACCGCCGCCTCCGGGGTTCAGG - Intergenic
910980926 1:92960002-92960024 CGCCTCGGCCTCCCAAGTGCCGG + Intronic
911013780 1:93309714-93309736 AACCTCTGCCTCCCGAGTTCAGG - Intergenic
911016204 1:93335527-93335549 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
912338255 1:108883991-108884013 AACCTCCGCCTCCCGGGTTCAGG + Intronic
912394818 1:109334062-109334084 AACCTCCGCCTCCCGGGTTCAGG - Intronic
912679241 1:111718446-111718468 AACCTCCGCCTCCCGGGTTCAGG - Intronic
912834078 1:112980141-112980163 TGCCTCAGCCTCCCGAGTCCTGG + Intergenic
913370862 1:118097151-118097173 AACCTCCGCCTCCTGAGTTCAGG - Intronic
914011317 1:143781198-143781220 CGCCTCAGCCTCCCAAGTGCTGG - Intergenic
914166517 1:145179938-145179960 CGCCTCAGCCTCCCAAGTGCTGG + Intergenic
914428588 1:147600129-147600151 CGCCGGCGCCTCCCCCTTTCCGG - Intronic
914801357 1:150964942-150964964 AGCCTCCGCCTCCCGGGTTCAGG + Intronic
914871003 1:151473607-151473629 CGCCGCTCCCTCCCGGGTTGCGG - Intergenic
915084118 1:153373338-153373360 CGCCCCAGCCTCCTGAGTACTGG + Intergenic
915353924 1:155244316-155244338 AACCTCCGCCTCCCGGGTTCAGG - Intronic
915919986 1:159968926-159968948 TGCCTCAGCCTCCCGAGTACAGG - Intergenic
915966522 1:160313660-160313682 CGCCTCAGCCTCCCAAGTGCTGG + Intronic
916658805 1:166901940-166901962 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
916691568 1:167194840-167194862 AGCCTCCACCTCCCGGGTTCAGG - Intergenic
916802647 1:168229299-168229321 AGGCTCCGCCTCCCGGGTTCAGG + Intronic
917388384 1:174503577-174503599 AACCTCCGCCTCCCGAGTTCAGG - Intronic
917544667 1:175951165-175951187 AGCCTCCACCTCCCGGGTTCAGG - Intronic
917557920 1:176111068-176111090 AACCTCCGCCTCCCGGGTTCAGG - Intronic
918030569 1:180804223-180804245 TGCCTCAGCCTCCCGAGTGCTGG + Intronic
918609185 1:186466755-186466777 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
919441753 1:197643234-197643256 AACCTCCGCCTCCCGGGTTCAGG + Intronic
919441781 1:197643403-197643425 CACCTCGGCCTCCCAAGTTCTGG + Intronic
919650603 1:200145226-200145248 AACCTCCGCCTCCCGGGTTCAGG - Intronic
919691045 1:200528577-200528599 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
919929897 1:202214377-202214399 CGAGGCCGCCTCCCCACTTCCGG + Intronic
919958503 1:202441968-202441990 TGCCTCAGCCTCCCGAGTACAGG + Intronic
920168168 1:204051136-204051158 CACCTCCGCCTCCCGGGTTCAGG + Intergenic
920924475 1:210328865-210328887 CGCCGCGGGTTCCCGAGTCCGGG + Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921214521 1:212925594-212925616 AGCCTCCGCCTCCCAGGTTCAGG - Intergenic
921583795 1:216925353-216925375 AACCTCCGCCTCCCGGGTTCAGG - Intronic
921729004 1:218555765-218555787 TGCCTCAGCCTCCCGAGTGCTGG + Intergenic
922052106 1:222001561-222001583 AACCTCCGACTCCCGAGTTCAGG - Intergenic
922069652 1:222178948-222178970 TGCCTCAGCCTCCCAAGTTCTGG - Intergenic
922123707 1:222701042-222701064 AATCTCCGCCTCCCGAGTTCAGG + Intronic
922196518 1:223364305-223364327 CGCCGCGCGCTCGCGAGTTCAGG - Intergenic
922434656 1:225591681-225591703 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
922538341 1:226400215-226400237 CACCTCCGCCTCCCGGGTTCAGG - Intronic
922602159 1:226864744-226864766 AACCTCCGCCTCCTGAGTTCAGG + Intergenic
922645656 1:227283941-227283963 TGCCCCAGCCTCCCGAGTGCTGG - Intronic
923465121 1:234241485-234241507 CGCCTCTGCCTCCCAAGTGCTGG - Intronic
923493955 1:234508696-234508718 TGCCTCAGCCTCCCGAGTACTGG + Intergenic
923583524 1:235242164-235242186 AACCTCCGCCTCCCGGGTTCAGG - Intronic
923605199 1:235437045-235437067 AACCTCCGCCTCCTGAGTTCAGG - Intronic
923720710 1:236464512-236464534 AACCTCCGCCTCCCGGGTTCAGG + Intronic
923895351 1:238263593-238263615 AGCCTCCACCTCCCGGGTTCTGG + Intergenic
924221929 1:241886099-241886121 CGCCACGGCCTCCCAAGTGCTGG + Intronic
924326998 1:242905257-242905279 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
924508069 1:244704738-244704760 AACCTCCGCCTCCCGGGTTCAGG + Intronic
924580050 1:245315638-245315660 AACCTCCGCCTCCTGAGTTCAGG - Intronic
924680604 1:246228049-246228071 AACCTCCGCCTCCCGGGTTCAGG + Intronic
924721416 1:246626537-246626559 AACCTCCGCTTCCCGAGTTCAGG + Intronic
924727530 1:246684267-246684289 AGCCTGCGCCTCCAGAGTTCAGG + Intergenic
924853069 1:247850406-247850428 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1062821543 10:537869-537891 AGCCTCCACCTCCCAAGTTCAGG + Intronic
1063077307 10:2730356-2730378 CGCCTCAGCCTCCCCAGTGCTGG - Intergenic
1063220062 10:3959017-3959039 TGCCTCAGCCTCCCGAGTACAGG + Intergenic
1063489336 10:6448488-6448510 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1063510573 10:6641332-6641354 AGCCCCCGCCTCCCGGGTTCAGG - Intergenic
1063588810 10:7376920-7376942 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
1063897834 10:10700942-10700964 CGCCTCCACCTACCAAGTTCTGG + Intergenic
1064392652 10:14955011-14955033 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1064471839 10:15643359-15643381 AGCCTCCGCCTCCCGGGTTCAGG + Intronic
1065353387 10:24815629-24815651 TGCCTCAGCCTCCCGAGTACTGG - Intergenic
1065576588 10:27126345-27126367 AGCCACAACCTCCCGAGTTCAGG - Intronic
1065592747 10:27282477-27282499 AACCTCCGCCTCCCGAGTTCAGG + Intergenic
1065641420 10:27786518-27786540 AACCTCCACCTCCCGAGTTCAGG + Intergenic
1065657618 10:27967807-27967829 AACCTCCGCCTCCCGAGTTCAGG - Intronic
1065711494 10:28522323-28522345 AGCCTCCGCCTCCTGGGTTCAGG - Intergenic
1065716518 10:28574522-28574544 AGCCTCTGCCTCCCGGGTTCTGG + Intronic
1066216452 10:33292902-33292924 AACCTCTGCCTCCCGAGTTCAGG - Intronic
1066344092 10:34565513-34565535 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1066464807 10:35641993-35642015 CGCCGCCGCCGCCGGAGTTGGGG + Exonic
1066572444 10:36788084-36788106 CGCCTCGGCTTCCCAAGTTCTGG + Intergenic
1066731710 10:38442469-38442491 CACCTCAGCCTCCCGAGTACCGG - Intergenic
1067111481 10:43404217-43404239 AGCCTCCGCCTCCTGGGTTCAGG - Intronic
1067122631 10:43487529-43487551 AGACTCCGCCTCCCGGGTTCAGG + Intergenic
1067220893 10:44343597-44343619 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1067458905 10:46443094-46443116 TGCCTCAGCCTCCCGAGTGCTGG + Intergenic
1067628291 10:47941538-47941560 TGCCTCAGCCTCCCGAGTGCTGG - Intergenic
1067629102 10:47946772-47946794 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1067761527 10:49051507-49051529 TGCCTCAGCCTCCCGAGTACCGG + Intronic
1068305889 10:55207717-55207739 CGCCTCAGCCTCCCAAGTGCTGG - Intronic
1068709476 10:60117730-60117752 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1069348052 10:67493311-67493333 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
1069376542 10:67798877-67798899 TGCCTCAGCCTCCCGAGTGCTGG + Intronic
1069483172 10:68802362-68802384 TGCCTCAGCCTCCCAAGTTCTGG - Intergenic
1069654483 10:70077621-70077643 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
1069687652 10:70328834-70328856 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1070024580 10:72620264-72620286 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1070114302 10:73514202-73514224 CACCTCCGCCTCCCAAGTGCTGG + Intronic
1070262406 10:74870658-74870680 AGCCTCCGCCTCCTGGGTTCAGG + Intronic
1070291360 10:75117306-75117328 CACCTCAGCCTCCTGAGTTCTGG - Intronic
1070302518 10:75214604-75214626 AACCTCCGCCTCCTGAGTTCAGG + Intronic
1070610038 10:77926697-77926719 AGCGGCCGCCTCCCGGGCTCCGG + Intergenic
1070949425 10:80419065-80419087 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1071580665 10:86766727-86766749 TGCCTCAGCCTCCCGAGTACAGG + Intronic
1071800128 10:89050616-89050638 TGCCTCAGCCTCCCGAGTACTGG + Intergenic
1072139637 10:92578011-92578033 CGCCTCAGCCTTCCGAGTGCTGG - Intergenic
1072416785 10:95253572-95253594 CACCTCCACCTCCCGGGTTCAGG - Intronic
1072427617 10:95343366-95343388 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1072510846 10:96123506-96123528 CGCCTCAGCCTCCAGAGTGCTGG - Intergenic
1072553993 10:96500702-96500724 AGCCTCCGCCTCCCGGGCTCAGG - Intronic
1072593855 10:96853294-96853316 CGCCTCAGCCTCCCAAGTGCTGG + Intronic
1072595495 10:96867964-96867986 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1073219829 10:101861933-101861955 TGCCTCAGCCTCCCGAGTGCTGG - Intronic
1073226579 10:101925827-101925849 AACCTCCGCCTCCTGAGTTCAGG - Intronic
1073304952 10:102495613-102495635 TGCCTCAGCCTCCCGAGTACTGG - Intronic
1073314162 10:102566681-102566703 AACCTCCGCCTCCCAAGTTCAGG - Intronic
1073316731 10:102586589-102586611 AAGCTCCGCCTCCCGAGTTCTGG - Intronic
1073392466 10:103191141-103191163 CGCCTCGGCCTCCCAAGTACTGG - Intronic
1074039841 10:109777557-109777579 AACCTCCGCCTCCTGAGTTCAGG + Intergenic
1074124353 10:110516387-110516409 AGCCTCCGCCTCCCGGGTTCAGG + Intergenic
1074234686 10:111573462-111573484 CGCCCCAGCCTCCCAAGTGCTGG + Intergenic
1075103699 10:119523581-119523603 AGCCTCCGCCTCCTGGGTTCAGG - Intronic
1075337832 10:121621384-121621406 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1075399860 10:122153075-122153097 AGCCTCCGCCTCCCAGGTTCAGG + Intronic
1075479989 10:122771567-122771589 CACCGCGGCCTCCCAAGTGCTGG - Intergenic
1075483894 10:122804871-122804893 TGCTGCCGCCTGCTGAGTTCCGG + Intergenic
1075600345 10:123763119-123763141 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1075755421 10:124807569-124807591 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1075769937 10:124924987-124925009 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1076303712 10:129447990-129448012 AACCTCCGCCTCCTGAGTTCAGG - Intergenic
1076554205 10:131311513-131311535 CGCCGCCGCCGCCCTGGGTCTGG - Exonic
1076878941 10:133230754-133230776 CGCCGCCGCTCCCCGGGGTCCGG + Exonic
1078028312 11:7721248-7721270 CGCCTCAGCCTCCCAAGTGCTGG + Intergenic
1078261400 11:9712818-9712840 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1078497184 11:11829766-11829788 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1078597211 11:12697772-12697794 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
1078607277 11:12788042-12788064 AACCTCCGCCTCCAGAGTTCGGG + Intronic
1079185156 11:18229955-18229977 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1079339763 11:19602257-19602279 AACCTCCGCCTCCCGAGTTCAGG + Intronic
1080048543 11:27835341-27835363 AGCCTCCACCTCCCGGGTTCAGG + Intergenic
1080340614 11:31259269-31259291 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1080532371 11:33189430-33189452 CGCCTCAGCCTCCCAAGTGCTGG + Intergenic
1080548243 11:33343359-33343381 CACCTCCACCTCCTGAGTTCAGG + Intronic
1081259098 11:40936449-40936471 TGCCTCAGCCTCCCGAGTACTGG + Intronic
1081544900 11:44064826-44064848 CGCCTCGGCCTCCCAAGTGCTGG - Intergenic
1081727577 11:45341963-45341985 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1082049466 11:47758998-47759020 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1082173571 11:49035471-49035493 TGCCTCAGCCTCCCGAGTACCGG + Intronic
1083276756 11:61601230-61601252 CGCCTCGGCCTCCCGACCTCAGG - Intergenic
1083409878 11:62484869-62484891 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1083420115 11:62547556-62547578 CGCCCCCGCCTCCCCACTTGCGG + Intronic
1083423394 11:62569221-62569243 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
1083461379 11:62814705-62814727 AACCGCTGCCTCCCGGGTTCAGG + Intronic
1083472295 11:62892075-62892097 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1083578994 11:63813293-63813315 TCCCGCCGCCTCCCGGGTCCAGG + Intergenic
1083657029 11:64234676-64234698 CGCGGCCCCCTCCCGAGCCCTGG - Exonic
1083696506 11:64446833-64446855 AACCTCCGCCTGCCGAGTTCAGG + Intergenic
1083774394 11:64887169-64887191 CGCCTCAGCCTCCCGAGTAGCGG - Intronic
1083795829 11:65016123-65016145 AGTCTCCGCCTCCCGGGTTCTGG - Intronic
1083800294 11:65042621-65042643 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1083922363 11:65787635-65787657 CGCCCCCGCCCCCCGAGTCCCGG - Intronic
1083936956 11:65874165-65874187 AACCTCCACCTCCCGAGTTCAGG - Intergenic
1083985978 11:66215648-66215670 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
1084062014 11:66682146-66682168 CGCCTCCCCCTCCCAGGTTCAGG + Intergenic
1084133155 11:67153231-67153253 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1084469367 11:69347552-69347574 CGCCTCAGCCTCCCGAGTGCTGG + Intronic
1085101857 11:73807717-73807739 AACCTCCGCCTCCCAAGTTCAGG + Intronic
1085301032 11:75458422-75458444 CGCCTCAGCCTCCCAAGTGCTGG - Intronic
1085538584 11:77244279-77244301 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1085613577 11:77975872-77975894 CACCTCTGCCTCCCGGGTTCAGG - Intronic
1086359924 11:86048017-86048039 AGCCTCTGCCTCCCGAGTTCAGG - Intronic
1086597709 11:88593594-88593616 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1086896192 11:92315635-92315657 CGCCTCAGCCTCCCGAGTAGCGG + Intergenic
1087098115 11:94339377-94339399 AACCTCTGCCTCCCGAGTTCAGG + Intergenic
1087108130 11:94432557-94432579 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
1087656826 11:100934033-100934055 CGCCACGGCCTCCCAAGTGCTGG + Intronic
1087684475 11:101247858-101247880 CGCCACCTCCTCCAGAGTTGCGG + Intergenic
1088274125 11:108066227-108066249 CGCCTCAGCCTCCTGAGTACTGG - Intronic
1088333415 11:108676693-108676715 CGCCTCCTCCTCCAAAGTTCTGG + Intronic
1088337040 11:108717389-108717411 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1088658348 11:112023729-112023751 TGCCTCAGCCTCCCGAGTGCTGG - Intergenic
1089046325 11:115504320-115504342 CGGCGGCGCCTCCCGGGCTCCGG - Exonic
1089521338 11:119066314-119066336 CGCCTCGGCCTCCCAAGTACTGG - Intergenic
1090353325 11:126121938-126121960 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1090522918 11:127498170-127498192 AACCTCCGCCTCCTGAGTTCAGG + Intergenic
1090804341 11:130193549-130193571 AACCTCCGCCTCCCGGGTTCCGG + Intronic
1091413684 12:261675-261697 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
1091437797 12:486454-486476 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1091492918 12:948811-948833 TGCCTCCGCCTCCCGAGTAGCGG + Intronic
1091496903 12:980681-980703 AACCGCCGCCTCCTGGGTTCAGG + Intronic
1091548206 12:1518625-1518647 TGCCGCCCCCTCCCTGGTTCTGG + Intergenic
1091732406 12:2890855-2890877 CGCCGCCGCGTCCCGCCTCCTGG - Intronic
1091898587 12:4124361-4124383 GACCTCCGCCTCCCGGGTTCAGG + Intergenic
1091968988 12:4770218-4770240 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1092240747 12:6834854-6834876 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1093055394 12:14550794-14550816 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1093327430 12:17795004-17795026 AACCTCCGCCTCCCGGGTTCGGG - Intergenic
1093818314 12:23578037-23578059 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
1094495761 12:30988339-30988361 TGCCTCCGCCTCCCAAGTGCTGG - Intronic
1094534121 12:31305946-31305968 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1094541196 12:31364446-31364468 CTCCTCCACCTCCCGGGTTCAGG - Intergenic
1094556121 12:31501689-31501711 AGCCTCCACCTCCCGGGTTCAGG - Intronic
1095700384 12:45185193-45185215 AACCTCCGTCTCCCGAGTTCAGG - Intergenic
1095886633 12:47195080-47195102 CGCCTCCGCCTCCCAAATGCTGG - Intronic
1096048361 12:48584662-48584684 CGCCTCAGCCTCCCAAGTGCTGG - Intergenic
1096388591 12:51212173-51212195 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1096392142 12:51237961-51237983 AGCCTCCACCTCCCGGGTTCAGG - Intergenic
1096410795 12:51375940-51375962 AGCCTACGCCTCCCGGGTTCAGG + Intronic
1096637128 12:52967252-52967274 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1096640575 12:52991143-52991165 TGCCTCAGCCTCCCGAGTACTGG + Intergenic
1096719352 12:53509585-53509607 CCCCTCTGCCTCCCGGGTTCAGG + Intronic
1096738862 12:53677180-53677202 CGCCGCCCCCTCCCGGCTCCCGG + Intronic
1096987237 12:55768205-55768227 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1097017283 12:55996589-55996611 CGCCTCAGCCTCCCGAGTACTGG + Exonic
1097114847 12:56689498-56689520 AACCTCCGCCTCCCGGGTTCGGG - Intergenic
1097992410 12:65849798-65849820 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1098050026 12:66443534-66443556 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1098246850 12:68528660-68528682 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1100261282 12:92934573-92934595 CGCCTCAGCCTCCCAAGTGCTGG - Intergenic
1100303274 12:93327058-93327080 AACCTCCGCCTCCCGAGTTGAGG - Intergenic
1100535122 12:95501466-95501488 CGCCTCAGCCTCCCAAGTGCTGG - Intronic
1100974948 12:100112776-100112798 CACCTCCGCCTCCCGGGTTCAGG - Intronic
1101142310 12:101808864-101808886 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
1101166859 12:102046407-102046429 TGCCTCAGCCTCCCGAGTGCTGG + Intronic
1101466806 12:104957981-104958003 CGCCGCCGGGTCCCGAGCCCAGG + Intronic
1101713097 12:107287060-107287082 AACCTCCGCCTCCTGAGTTCAGG + Intergenic
1101749294 12:107570326-107570348 TGCCTCAGCCTCCCGAGTACCGG + Intronic
1102054023 12:109882737-109882759 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1102172731 12:110854374-110854396 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1102305325 12:111800262-111800284 CTCCGCTGCCTGCCAAGTTCAGG - Intronic
1102312099 12:111853614-111853636 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1102359930 12:112276691-112276713 CGCCACAGCCTCCCAAGTGCTGG + Intronic
1102383517 12:112487214-112487236 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1102393778 12:112570853-112570875 CACCTCCACCTCCTGAGTTCAGG + Intronic
1102677437 12:114668191-114668213 CCCCAGCGCCTCCCGGGTTCCGG - Intergenic
1102846763 12:116193044-116193066 AACCTCCGCCTCCCCAGTTCAGG - Intronic
1102867620 12:116386640-116386662 AGCCTCCGCCTCCCGGGTTCAGG + Intergenic
1103089586 12:118088161-118088183 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
1103108408 12:118252067-118252089 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1103475676 12:121216736-121216758 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1103498262 12:121379930-121379952 TGCCTCAGCCTCCCAAGTTCTGG + Intronic
1103649618 12:122422579-122422601 GGCCGCCGCCTCCCGCCTCCCGG + Intronic
1103826222 12:123741180-123741202 CGCCTCAGCCTCCAGAGTGCTGG - Intronic
1103968625 12:124655763-124655785 CCCCGCCGCCTCCCCAGCTGAGG + Intergenic
1104023351 12:125008558-125008580 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1104196831 12:126548394-126548416 CACCTCCGCCTCCCGGGTTCAGG + Intergenic
1104625857 12:130353842-130353864 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1104960733 12:132487558-132487580 AGCCGCCGTCTCTGGAGTTCTGG - Intergenic
1104996338 12:132659938-132659960 CGCCGAGGCCTCCCAAGTGCTGG + Intronic
1105274530 13:18906841-18906863 CGCAGCTGCCTCCCCACTTCAGG - Intergenic
1105332781 13:19433387-19433409 TGCCTCAGCCTCCCGAGTGCTGG - Intronic
1105369004 13:19786357-19786379 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1105596362 13:21843145-21843167 CGCCTCGGCCTCCCAAGTGCTGG - Intergenic
1105655822 13:22437122-22437144 CGCCTCGGCCTCCGAAGTTCTGG + Intergenic
1106274840 13:28194073-28194095 AACCTCCGCCTCCCTAGTTCAGG - Intronic
1106529089 13:30571374-30571396 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1106730545 13:32537821-32537843 CGCCTCAGCCTCCCAAGTGCTGG - Intronic
1106738601 13:32614377-32614399 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1106877570 13:34090437-34090459 CGCCTCAGCCTCCCGAGTAGGGG - Intergenic
1107134340 13:36927029-36927051 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1107562957 13:41573697-41573719 AGCCTCTGCCTCCCGGGTTCGGG + Intronic
1107624841 13:42272044-42272066 CGCCGCCGCCGCCGCAGCTCCGG - Intergenic
1107916750 13:45159720-45159742 CGCCTCAGCCTCCCAAGTTCTGG + Intronic
1108189546 13:47923514-47923536 AACCTCCGCCTCCTGAGTTCAGG - Intergenic
1108193127 13:47963561-47963583 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1108214753 13:48173218-48173240 CGCCTCGGCCTCCCGAGTGCTGG + Intergenic
1108357789 13:49642818-49642840 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1108518256 13:51222507-51222529 CGCCGCCGCCGCCCGCCTTTGGG - Exonic
1108578623 13:51810392-51810414 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1109338614 13:61025821-61025843 CGCCTCGGCCTCCCAAGTGCTGG - Intergenic
1110160119 13:72366896-72366918 CGCCTCAGCCTCCCAAGTGCTGG + Intergenic
1110190654 13:72726347-72726369 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1110240132 13:73257839-73257861 CGCCTCAGCCTCCCAAGTGCTGG + Intergenic
1110319837 13:74148894-74148916 AGCCTCCGCCTCCCGGGTTCAGG + Intergenic
1110571661 13:77011256-77011278 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1110718143 13:78731161-78731183 TGCCTCCGCCTCCTGGGTTCAGG + Intergenic
1110724231 13:78801194-78801216 AACCTCCGCCTCCCGAGTTCAGG + Intergenic
1111314897 13:86542341-86542363 CGCCTCAGCCTCCCGAGTGCTGG - Intergenic
1111576314 13:90158224-90158246 AAGCTCCGCCTCCCGAGTTCAGG + Intergenic
1111670994 13:91330450-91330472 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1112081356 13:95974965-95974987 TGCCTCAGCCTCCCGAGTACTGG - Intronic
1112134280 13:96559196-96559218 AACCTCTGCCTCCCGAGTTCAGG + Intronic
1112453054 13:99530174-99530196 CGCCTCAGCCTCCCAAGTGCTGG - Intronic
1112537886 13:100278559-100278581 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1112652699 13:101416276-101416298 CGCCGCAGCCTCCCGGGCACCGG + Intronic
1113154797 13:107307563-107307585 AACCTCCGCCTCCCGAGTTCAGG + Intronic
1113491070 13:110692387-110692409 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1113855601 13:113443859-113443881 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1114176001 14:20320721-20320743 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1114191045 14:20439807-20439829 CGCCTCAGCCTCCCAAGTACAGG + Intergenic
1114309222 14:21451488-21451510 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1114419219 14:22566414-22566436 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1114968269 14:27992226-27992248 CGCCTCGGCCTCCCAAGTGCTGG + Intergenic
1115120036 14:29927780-29927802 CGGCGGCGCCTCCCCAGTGCCGG - Intronic
1115270606 14:31548132-31548154 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1115542224 14:34431662-34431684 AGCCACTGCCTCCCGGGTTCAGG - Intronic
1115590180 14:34856774-34856796 AACCTCTGCCTCCCGAGTTCAGG - Intronic
1116005595 14:39287153-39287175 AGCCTCAGCCTCCCGGGTTCAGG + Intronic
1116620218 14:47192364-47192386 CACCTCGGCCTCCCAAGTTCTGG - Intronic
1116822174 14:49636119-49636141 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1116831620 14:49725927-49725949 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1116890559 14:50264021-50264043 CGCCTCAGCCTCCCAAGTGCTGG + Intronic
1117122926 14:52588224-52588246 ACCCTCTGCCTCCCGAGTTCAGG + Intronic
1117364433 14:55011440-55011462 AACCGCCGCCTCCCGGGTTCAGG - Intronic
1117380055 14:55153291-55153313 CGCCGCTGCCTCCCAAGTGCTGG - Intronic
1117406250 14:55407208-55407230 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1117424629 14:55580868-55580890 CGCCGCTGCCTCCGGCGGTCTGG + Intronic
1118108961 14:62694650-62694672 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1118185188 14:63531084-63531106 AACCTCCGCCTCCCGAGTTCAGG - Intronic
1118292520 14:64539926-64539948 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1118740043 14:68732720-68732742 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1118780828 14:69006480-69006502 CACCCCCACCTCCCCAGTTCGGG + Intergenic
1118854230 14:69609104-69609126 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1119157575 14:72425218-72425240 AACCTCCACCTCCCGAGTTCAGG + Intronic
1119227427 14:72955027-72955049 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1119246573 14:73114645-73114667 CGCCTCAGCCTCCCAAGTACTGG - Intronic
1119316682 14:73702252-73702274 TGCCTCAGCCTCCCGAGTACTGG + Exonic
1119360642 14:74046452-74046474 AACCTCTGCCTCCCGAGTTCAGG + Intronic
1119366078 14:74092833-74092855 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1119503737 14:75153849-75153871 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1119588064 14:75856871-75856893 CACCTCCGCCTCCCAAGTGCTGG + Intronic
1119789098 14:77333135-77333157 TGCCTCAGCCTCCCGAGTACTGG + Intergenic
1119811870 14:77528311-77528333 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1120026082 14:79585601-79585623 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1120521822 14:85533675-85533697 CACCACCGCCTCCAGGGTTCGGG - Intronic
1121058530 14:90881369-90881391 AACCTCTGCCTCCCGAGTTCAGG - Intronic
1121284024 14:92720583-92720605 AACCGCCGCCTCCCGCATTCAGG - Intronic
1121287424 14:92747374-92747396 TGTCTCAGCCTCCCGAGTTCTGG - Intronic
1121473717 14:94175056-94175078 CGCTGACGCCGCCCGGGTTCTGG + Intronic
1121541964 14:94734896-94734918 AACCTCCGCCTCCTGAGTTCAGG + Intergenic
1122220847 14:100238583-100238605 CGCCACCGCCTCCCGCTTCCCGG - Intronic
1122451414 14:101811420-101811442 AGCCTCCACCTCCCGAGCTCAGG + Intronic
1122565029 14:102647758-102647780 AGCCTCCGCCTCCCGGATTCAGG + Intronic
1122618056 14:103034734-103034756 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1122620937 14:103057409-103057431 CGCCGCCGCCCTCCCAGCTCGGG + Exonic
1123054069 14:105561011-105561033 CCCCGCCGCTTCCCGAGCCCGGG - Intergenic
1123078654 14:105681428-105681450 CCCCGCCGCTTCCCGAGCCCGGG - Intergenic
1202872566 14_GL000225v1_random:177696-177718 CAGCGGCGCCTCCCGAGTCCCGG - Intergenic
1123490511 15:20776075-20776097 CGCCGCCGCCGCCCCAGTGTCGG - Intergenic
1123547012 15:21345162-21345184 CGCCGCCGCCGCCCCAGTGTCGG - Intergenic
1123654941 15:22507620-22507642 CGCCGTGGCCTCCCAAGTGCTGG + Intergenic
1123675923 15:22710343-22710365 GGCCTCCGCCTCCCGGGTTTGGG + Intergenic
1123676010 15:22710799-22710821 GGCCTCCGCCTCCCGGGTTTGGG + Intergenic
1123709409 15:22976237-22976259 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1123722104 15:23068965-23068987 GGCCTCCGCCTCCCGGGTTTGGG + Intergenic
1123734777 15:23175134-23175156 GGCCTCCGCCTCCCGGGTTTGGG - Intergenic
1123753139 15:23373790-23373812 GGCCTCCGCCTCCCGGGTTTGGG - Intergenic
1123753207 15:23374205-23374227 GGCCTCCGCCTCCCGGGTTTGGG - Intergenic
1123764754 15:23466854-23466876 AGCCTCCGCCTCCCGGGTTTGGG + Intergenic
1123813767 15:23955542-23955564 CGCCTCCGCCTTCCAAGTGCTGG - Intergenic
1123908916 15:24947544-24947566 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1124285279 15:28396436-28396458 GGCCTCCGCCTCCCGGGTTTGGG - Intergenic
1124297417 15:28515190-28515212 GGCCTCCGCCTCCCGGGTTTGGG + Intergenic
1124327919 15:28783269-28783291 GGCCTCCGCCTCCCGGGTTTGGG + Intergenic
1124328211 15:28784714-28784736 GGCCTCCGCCTCCCGGGTTTGGG + Intergenic
1124463597 15:29916161-29916183 AACCTCCACCTCCCGAGTTCAGG - Intronic
1124472704 15:30002479-30002501 AGCCTCCGCCTCCCAGGTTCAGG + Intergenic
1124574695 15:30897001-30897023 AGCCTCCGCCTCCCGGGTTTGGG - Intergenic
1124668581 15:31616656-31616678 TGCCTCAGCCTCCCGAGTACTGG + Intronic
1124850770 15:33336805-33336827 CGCCTCAGCCTCCCAAGTGCTGG - Intronic
1124912118 15:33931616-33931638 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1125185251 15:36922700-36922722 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1125414732 15:39440527-39440549 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1125625952 15:41109367-41109389 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1125964524 15:43863015-43863037 AGCCTCCGCCTCCTGGGTTCAGG + Intronic
1126021952 15:44410315-44410337 TGCCTCAGCCTCCCGAGTACAGG - Intronic
1126182376 15:45798169-45798191 AACCTCCGCCTCCAGAGTTCAGG + Intergenic
1126409362 15:48356134-48356156 CGCCTCGGCCTCCCAAGTGCTGG + Intergenic
1126438960 15:48666347-48666369 AACCTCCGGCTCCCGAGTTCAGG - Intergenic
1126626820 15:50693331-50693353 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1126716361 15:51522394-51522416 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
1127082908 15:55397893-55397915 AACCTCCACCTCCCGAGTTCAGG - Intronic
1127112708 15:55691597-55691619 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1127144081 15:56007186-56007208 CGCCGCCGCCGCCCGGATCCTGG - Intergenic
1127432126 15:58920539-58920561 AGCCTCCACCTCCCGGGTTCAGG - Intronic
1127441354 15:59012098-59012120 AACCTCCGCCTCCTGAGTTCAGG + Intronic
1127860894 15:62993623-62993645 TGCTGCAGCCTCCCGAGTACTGG - Intergenic
1127957640 15:63866889-63866911 CGCCTCAGCCTCCTGAGTACAGG + Intergenic
1128050041 15:64656143-64656165 AACCTCCGCCTCCCGTGTTCAGG + Intronic
1128274584 15:66342106-66342128 TGCCTCCGCCTCCCGGGTCCCGG - Intronic
1128566086 15:68701057-68701079 CACCCCCACCTCCCGAGCTCCGG + Intronic
1128949602 15:71863005-71863027 AGCCTCCGCCTCCTGGGTTCAGG + Intronic
1128972249 15:72117992-72118014 CGCCGCCGCCTCTCGCAGTCCGG + Exonic
1129313127 15:74725956-74725978 CGCCCCCGCCTGCCGAGTCCTGG - Intergenic
1129440589 15:75578635-75578657 GGCCTCTGCCTCCCGAGTGCCGG - Intronic
1129504215 15:76067517-76067539 TGCCTCAGCCTCCCGAGTACAGG - Intronic
1129655626 15:77523578-77523600 AGGCTCCGCCTCCCAAGTTCAGG + Intergenic
1129809735 15:78499932-78499954 AACCTCCGCCTCCCGGGTTCAGG + Exonic
1129933729 15:79432339-79432361 CGCCTCCGCCGCCCGAGTCCAGG - Intergenic
1130116221 15:81006759-81006781 CGCCTCGGCCTCCCAAGTGCTGG + Intergenic
1130653652 15:85776841-85776863 AACCTCCGCCTCCTGAGTTCAGG - Intronic
1130883799 15:88076978-88077000 TGCCTCAGCCTCCCGAGTACTGG - Intronic
1131207912 15:90467008-90467030 AGCCTCTGCCTCCCGGGTTCAGG - Intronic
1131280079 15:91013967-91013989 CGCCTCAGCCTCCCAAGTGCTGG - Intronic
1131387990 15:92023548-92023570 AGCCTCTGCCTCCCGGGTTCAGG + Intronic
1131677525 15:94685416-94685438 AATCTCCGCCTCCCGAGTTCAGG - Intergenic
1131819844 15:96261030-96261052 TGCCTCAGCCTCCCGAGTACTGG - Intergenic
1132012090 15:98285083-98285105 CGCCTCGGCCTCCCAAGTGCTGG + Intergenic
1132183014 15:99776472-99776494 CGCCTCGGCCTCCCGAGTAGCGG + Intergenic
1132370425 15:101294152-101294174 AACCGCCGCCTCCCCGGTTCAGG - Intronic
1132411073 15:101578616-101578638 CTCCGCCCCCTCCCCACTTCTGG - Intergenic
1132414636 15:101611475-101611497 TGCCTCAGCCTCCCGAGTACAGG - Intergenic
1202955344 15_KI270727v1_random:72378-72400 CGCCGCCGCCGCCCCAGTGTCGG - Intergenic
1132771549 16:1566541-1566563 AGCCTCCGCCTCCCGGGCTCAGG + Intronic
1132794125 16:1710357-1710379 TGCCTCAGCCTCCCGAGTGCTGG - Intronic
1132860774 16:2070718-2070740 GGCCGCAGCCTCCCCAGTCCTGG + Intronic
1132965232 16:2650095-2650117 AACCTCCGCCTCCTGAGTTCAGG - Intergenic
1133115266 16:3574878-3574900 AGCCTCCACCTCCTGAGTTCAGG - Intronic
1133171825 16:3986537-3986559 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1133666295 16:7971434-7971456 CACCTCCACCTCCCGGGTTCAGG + Intergenic
1133927952 16:10209007-10209029 AACCTCCGCCTCCGGAGTTCAGG + Intergenic
1134014012 16:10876073-10876095 AACCTCCGCCTCCCGGGTTCTGG - Intergenic
1134572207 16:15300779-15300801 AACCTCCGCCTCCCGGGTTCCGG + Intergenic
1134617027 16:15659548-15659570 CGCCTCAGCCTCCCGAGTAGTGG + Intronic
1134668092 16:16034274-16034296 CGCCTCAGCCTCCAGAGTGCTGG + Intronic
1134701268 16:16267514-16267536 AGCCTCCGCCTCCTGGGTTCAGG + Intronic
1134730174 16:16455269-16455291 AACCTCCGCCTCCCGGGTTCCGG - Intergenic
1134748459 16:16606450-16606472 AACCTCCACCTCCCGAGTTCAGG + Intergenic
1134894415 16:17871737-17871759 CGCCTCAGCCTCCCGAGTAGCGG - Intergenic
1134937257 16:18256630-18256652 AACCTCCGCCTCCCGGGTTCCGG + Intergenic
1134997005 16:18747166-18747188 AACCTCCACCTCCCGAGTTCAGG - Intergenic
1135111185 16:19691954-19691976 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1135119274 16:19751362-19751384 CACCTCAGCCTCCCGAGTGCTGG - Intronic
1135259739 16:20970440-20970462 AACCTCCGCCTCCCCAGTTCAGG - Intronic
1135275171 16:21105931-21105953 CGCCTCAGCCTCCCAAGTGCTGG - Intronic
1135300925 16:21326431-21326453 TGCCTCAGCCTCCCAAGTTCTGG + Intergenic
1135351393 16:21732212-21732234 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1135449876 16:22548340-22548362 CGCCTCGGCCTCCCAAGTGCTGG + Intergenic
1135530350 16:23247688-23247710 CACCTCAGCCTCCCGAGTGCTGG - Intergenic
1135805420 16:25538182-25538204 TGCCTCAGCCTCCCGAGTACTGG + Intergenic
1135866938 16:26111933-26111955 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1135974728 16:27100627-27100649 AACCTCCGCCTCCTGAGTTCAGG - Intergenic
1136161359 16:28421239-28421261 CACCTCTGCCTCCTGAGTTCAGG - Intergenic
1136181247 16:28554088-28554110 CGTCGCCACCTACCGAGTCCGGG - Exonic
1136201605 16:28693752-28693774 CACCTCTGCCTCCTGAGTTCAGG + Intronic
1136217950 16:28807944-28807966 CACCTCTGCCTCCTGAGTTCAGG + Intergenic
1136290301 16:29267596-29267618 CGCCTCAGCCTCCCAAGTCCTGG - Intergenic
1136348592 16:29692812-29692834 CGCCTCCGCCTCCCAAGTGCTGG - Intronic
1136376595 16:29869331-29869353 CGCCTCAGCCTCCCAAGTGCTGG - Intergenic
1136423778 16:30154861-30154883 GGCCTCTGCCTCCCGGGTTCCGG - Intergenic
1136488182 16:30586385-30586407 AGCCTCCACCTCCCGAGTTCAGG - Intergenic
1136524309 16:30818534-30818556 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1136779114 16:32885984-32886006 CGCCGCCGCCACCGGAGTCTCGG - Intergenic
1136891503 16:33975534-33975556 CGCCGCCGCCACCGGAGTCTCGG + Intergenic
1137429558 16:48407547-48407569 CGCCTCAGCCTCCCAAGTGCTGG + Intronic
1137605789 16:49786142-49786164 CGCCCCCGCCTCCGGACTGCAGG + Intronic
1137968416 16:52959475-52959497 CGCCTCAGCCTCCCAAATTCTGG + Intergenic
1137972170 16:52996573-52996595 TGCCTCCGCCTCCCAAGTGCTGG - Intergenic
1138014157 16:53413849-53413871 GGCCTCCGCCTCCCGGGTTTGGG + Intergenic
1138035583 16:53602690-53602712 AACCTCCACCTCCCGAGTTCAGG - Intronic
1138077632 16:54058191-54058213 CTCCGCCGCCTCCAGGGTTCAGG + Intronic
1138173727 16:54876991-54877013 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1138587479 16:57979980-57980002 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1139238856 16:65369781-65369803 CGCCTCAGCCTCCCAAGTGCTGG + Intergenic
1139572430 16:67821493-67821515 AACCGCTGCCTCCCGGGTTCAGG - Intronic
1139787631 16:69406825-69406847 TGCCTCAGCCTCCCGAGTTAGGG + Intronic
1139796734 16:69489100-69489122 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1139798801 16:69504477-69504499 CGCCTCGGCCTCCCAAGTGCTGG - Intergenic
1139933863 16:70552990-70553012 GGCCTCCGCCTCCCGGGTTCAGG + Intronic
1140226735 16:73083776-73083798 CGCCTCAGCCTCCCAAGTGCTGG + Intergenic
1140501829 16:75439922-75439944 TGCCTCAGCCTCCCGAGTACAGG + Intronic
1140503136 16:75452217-75452239 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1140788024 16:78362525-78362547 TACCTCCACCTCCCGAGTTCAGG - Intronic
1141091401 16:81132743-81132765 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1141194668 16:81851592-81851614 AACCTCCGCCTCCCGAGTTCAGG + Intronic
1141352592 16:83311957-83311979 TGCCGCAGCCTCCCGAGAGCTGG - Intronic
1141471397 16:84240983-84241005 CGCCTCCGCCTCCAAAGTTCTGG - Intergenic
1141474235 16:84261704-84261726 CACCTCCGCCTCCCGGGTTCAGG + Intergenic
1141633901 16:85303717-85303739 GGCCGCCGCCTCCCGAGTTCTGG + Intergenic
1141709163 16:85688048-85688070 GGCCTCCGCCTCCCGGGTTCAGG - Intronic
1142335132 16:89483744-89483766 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1142537835 17:632131-632153 CGCCGCAGCCTCCCGAGTACAGG - Intronic
1142619642 17:1156600-1156622 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1142640929 17:1285627-1285649 CGCCTCTGCCTCCCGAGTCCTGG - Intronic
1142691888 17:1611551-1611573 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1142727512 17:1827258-1827280 TGCCTCCGCCTCCCGGGTTCAGG - Intronic
1142766882 17:2069512-2069534 AGCCTCCGCCTCCAGAGCTCAGG - Intronic
1142883294 17:2897254-2897276 AGCCTCCGCCTCCTGGGTTCCGG - Intronic
1142965489 17:3578224-3578246 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1142983159 17:3682942-3682964 AACCTCCACCTCCCGAGTTCAGG - Intronic
1142993651 17:3748335-3748357 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
1143144833 17:4768084-4768106 CACCTCCGCCTCCCGGGTTCAGG - Intergenic
1143149600 17:4799494-4799516 AACCTCCGCCTCCCGGGTTCTGG + Intergenic
1143221626 17:5266721-5266743 AACCTCCGCCTCCCAAGTTCAGG - Intergenic
1143241666 17:5448095-5448117 AACCTCTGCCTCCCGAGTTCAGG - Intronic
1143447032 17:7015667-7015689 AGCCGCCTCCTTCCGATTTCTGG - Intronic
1143487940 17:7265210-7265232 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1143796736 17:9342937-9342959 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1143911629 17:10255071-10255093 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1144003346 17:11076100-11076122 CGCCTCAGCCTCCCGAGTATAGG + Intergenic
1144349208 17:14378564-14378586 AGCCTCCGCCTCCCGGGTTCAGG + Intergenic
1144408195 17:14973423-14973445 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1144478323 17:15608533-15608555 AACCTCCGCCTCCCGAGTTCAGG + Intronic
1144517922 17:15931978-15932000 CGCCTCAGCCTCCCAAGTGCTGG + Intergenic
1144731147 17:17527117-17527139 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1144758550 17:17694561-17694583 CGCCGCCCCTTCTCGAGGTCGGG - Intronic
1144919971 17:18755179-18755201 AACCTCCGCCTCCCGAGTTCAGG - Intronic
1145000332 17:19300508-19300530 AGCCTCCGCCTCCTGGGTTCAGG + Intronic
1145063026 17:19744319-19744341 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1145195487 17:20890163-20890185 CGCCTCAGCCTCCCAAGTGCTGG - Intronic
1145745591 17:27317380-27317402 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1145805264 17:27722714-27722736 AACCTCCGCCTCCCAAGTTCAGG - Intergenic
1145919882 17:28602702-28602724 CGCCTCAGCCTCCTGAGTACTGG + Intronic
1145946659 17:28780798-28780820 AACCTCCGCCTCCCAAGTTCAGG - Intronic
1146026951 17:29330099-29330121 AACCTCTGCCTCCCGAGTTCAGG + Intergenic
1146049208 17:29535603-29535625 TGCCTCCGCCTCCCAAGTGCTGG - Intronic
1146070492 17:29676352-29676374 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1146432844 17:32814260-32814282 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1146942580 17:36854369-36854391 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1147046793 17:37758515-37758537 CGCCTCAGCCTCCCAAGTACTGG - Intergenic
1147300562 17:39522969-39522991 AACCTCCACCTCCCGAGTTCAGG - Intronic
1147642190 17:42009893-42009915 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
1147710195 17:42458181-42458203 AGCCTCCGCCTCCCGGGTTCAGG - Intergenic
1147804108 17:43117490-43117512 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
1147804575 17:43121291-43121313 CAGCTCCGCCTCCCGGGTTCAGG - Intronic
1147819503 17:43233251-43233273 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147820595 17:43239399-43239421 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147820807 17:43240664-43240686 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147821617 17:43245133-43245155 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147822711 17:43251291-43251313 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147825228 17:43266087-43266109 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147826069 17:43270822-43270844 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147826348 17:43272599-43272621 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147827236 17:43277451-43277473 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147828348 17:43283607-43283629 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147829458 17:43289771-43289793 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147830549 17:43295906-43295928 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147831233 17:43299494-43299516 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147843154 17:43386840-43386862 AACCTCTGCCTCCCGAGTTCAGG - Intergenic
1147850438 17:43438485-43438507 CGCCTCAGCCCCCCGAGTACTGG + Intergenic
1147929255 17:43967219-43967241 AGCCTCCGCCTCCCAGGTTCTGG - Intronic
1148086557 17:44997131-44997153 AGCCTCCGCCTCCTGGGTTCAGG + Intergenic
1148482360 17:47968394-47968416 AACCTCCGCCTCCCAAGTTCAGG + Intronic
1148663439 17:49355814-49355836 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1148725456 17:49786693-49786715 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
1148938803 17:51188871-51188893 TGCCTCAGCCTCCCGAGTGCTGG + Intronic
1149392311 17:56204293-56204315 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1149553800 17:57558946-57558968 CGCCTCAGCCTCCCGAGTAGTGG - Intronic
1149741011 17:59045555-59045577 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1149948131 17:60953813-60953835 AACCTCTGCCTCCCGAGTTCAGG + Intronic
1150068869 17:62135500-62135522 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1150218166 17:63481627-63481649 CCCCCATGCCTCCCGAGTTCTGG + Intergenic
1150236312 17:63595638-63595660 TGCCGCCGCCGCCTTAGTTCAGG - Intergenic
1150280376 17:63926706-63926728 CGCCTCGGCCTCCCAAGTGCTGG + Intergenic
1150422552 17:65051531-65051553 CACCTCCGCCTCCTGGGTTCAGG - Intronic
1150484588 17:65534846-65534868 AGCCTCCGCCTCCTGGGTTCAGG - Intronic
1150606819 17:66698864-66698886 TGCCTCAGCCTCCCGAGTACTGG - Intronic
1150665078 17:67126777-67126799 AGCCTCCGCCTCCCGGGTTTAGG - Intronic
1150900924 17:69276166-69276188 AACCTCCGCTTCCCGAGTTCAGG + Intronic
1151486612 17:74404821-74404843 CCCCACCTCCTCCCCAGTTCAGG + Intergenic
1151723014 17:75868951-75868973 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1151760886 17:76102324-76102346 CGCCTCAGCCTCCCAAATTCTGG - Intronic
1151775367 17:76197680-76197702 CACCTCAGCCTCCCGAGTGCTGG + Intronic
1151812166 17:76450867-76450889 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1152091069 17:78248237-78248259 CCCCGCTGCCTCCCGAGCTCTGG + Intergenic
1152171772 17:78755380-78755402 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1152401573 17:80069667-80069689 CACCTCCACCTCCCGGGTTCAGG - Intronic
1152423091 17:80204540-80204562 CACCTCTGCCTCCCGGGTTCAGG - Intronic
1152479559 17:80541221-80541243 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1152496840 17:80679159-80679181 AACTTCCGCCTCCCGAGTTCAGG - Intronic
1152553552 17:81041654-81041676 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1152628127 17:81397582-81397604 GGCCGGCGCCTCCCGAGCCCCGG - Intronic
1152810891 17:82382393-82382415 AGCCTCCGCCTCCCAGGTTCAGG + Intergenic
1152835178 17:82525249-82525271 AGCCTCCGCCTCCTGGGTTCTGG + Intronic
1152959672 18:71799-71821 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1153415849 18:4845052-4845074 AAGCTCCGCCTCCCGAGTTCAGG + Intergenic
1153551691 18:6269211-6269233 CGCCTCAGCCTCCCAAGTGCTGG - Intronic
1153636612 18:7117998-7118020 CGCGGCCGCCTCCCCGGCTCCGG + Intergenic
1153826426 18:8879125-8879147 CGCCACCGCCTCCAGAGTTGTGG - Intergenic
1154251623 18:12749789-12749811 AGCCTCCACCTCCCGGGTTCAGG + Intergenic
1154259221 18:12815000-12815022 AACCGCCGCCTCCTGGGTTCAGG - Intronic
1154951269 18:21212601-21212623 AGCCTCCGCCTCCCAGGTTCGGG + Intergenic
1154985388 18:21545846-21545868 AGCCTCCGCCTCCTGGGTTCAGG - Intronic
1155065658 18:22266784-22266806 AGCCTCCGCCTCCCAGGTTCAGG - Intergenic
1155335164 18:24756067-24756089 AGCCTCCGCCTCCCGAGTTCAGG - Intergenic
1155763491 18:29597911-29597933 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1155959449 18:31981896-31981918 AACCTCCGCCTCCCGAGTTGAGG + Intergenic
1156438339 18:37157693-37157715 TGCCTCAGCCTCCCGAGTGCTGG - Intronic
1156578117 18:38343028-38343050 AGCCTCCGCCTCCCAGGTTCAGG - Intergenic
1156719183 18:40049175-40049197 CTCCGCCGCCCCCCTAGTGCTGG - Intergenic
1157124981 18:44947752-44947774 CGCCTCGGCCTCCCAAGTACTGG + Intronic
1157384023 18:47247383-47247405 CCCCGCGGGCTCCCGGGTTCCGG - Intronic
1157604701 18:48918607-48918629 AGCCTCTGCCTCCCGGGTTCAGG - Intergenic
1158226952 18:55211134-55211156 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1158593006 18:58793013-58793035 TGCCTCAGCCTCCCGAGTGCTGG - Intergenic
1158922850 18:62213479-62213501 CGCCTCTGCCTCCCAAGTGCTGG - Intronic
1159752502 18:72319714-72319736 TGCCTCAGCCTCCCGAGTACAGG - Intergenic
1159971337 18:74658192-74658214 AACCTCCGCCTCCCGGGTTCCGG + Intronic
1160171228 18:76557169-76557191 AGCCTCCGCCTCCCGGGTTCCGG + Intergenic
1160231004 18:77048999-77049021 CAGCTCCGCCTCCCGGGTTCAGG + Intronic
1160514437 18:79470732-79470754 CGGCCCCGCCTCCCGTCTTCAGG + Intronic
1160604476 18:80039064-80039086 CGCCTCGGCATCCCGAGTTGCGG - Intronic
1160771320 19:832426-832448 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1160813353 19:1023454-1023476 CGCCTCGGCCTCCCAAGTGCTGG - Intergenic
1160862161 19:1242022-1242044 GGCCGCCGCCCCCGGAGTCCAGG + Intronic
1160876616 19:1299472-1299494 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1160997974 19:1893294-1893316 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1161023320 19:2022185-2022207 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1161123709 19:2544464-2544486 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1161190667 19:2953525-2953547 AACCTCCGCCTCCCAAGTTCAGG + Intergenic
1161292063 19:3499688-3499710 AACCTCCGCCTCTCGAGTTCAGG - Intronic
1161344366 19:3760665-3760687 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1161367369 19:3887999-3888021 TGCCTCAGCCTCCCGAGTACTGG - Intronic
1161369387 19:3901912-3901934 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1161380187 19:3960695-3960717 AGCCTCTGCCTCCCGGGTTCAGG - Intronic
1161417975 19:4158413-4158435 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1161421139 19:4176505-4176527 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1161438098 19:4275995-4276017 AACCTCTGCCTCCCGAGTTCAGG + Intergenic
1161515958 19:4696633-4696655 TGCCTCAGCCTCCCGAGTACAGG - Intronic
1161665941 19:5577061-5577083 AGGCTCCGCCTCCCGGGTTCAGG + Intergenic
1161707591 19:5829370-5829392 CGCCGACCCCTCCCGCGCTCTGG - Intergenic
1161795870 19:6386556-6386578 TGCCTCAGCCTCCCGAGTACTGG + Intronic
1161829899 19:6595026-6595048 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1161878023 19:6926975-6926997 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
1161923033 19:7280633-7280655 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1161939269 19:7392599-7392621 TGCCTCAGCCTCCCGAGTGCTGG - Intronic
1161957491 19:7504622-7504644 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
1161970386 19:7576147-7576169 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1162368364 19:10263468-10263490 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1162535847 19:11262487-11262509 CGCCGCCGCCTCCCGGTTCTGGG + Intergenic
1162542833 19:11308378-11308400 AGCCTCCGCCTCCCAGGTTCAGG + Intronic
1162730786 19:12717351-12717373 AACCTCCACCTCCCGAGTTCAGG + Intronic
1162768806 19:12937045-12937067 CACCTCAGCCTCCCGAGTACTGG + Intergenic
1162792012 19:13067989-13068011 TGCCTCAGCCTCCCGAGTACTGG - Intronic
1162999522 19:14357417-14357439 AACCTCCGCCTCCCCAGTTCAGG - Intergenic
1163030004 19:14537825-14537847 CACCTCCGCCTCCCGGGTTCAGG + Intronic
1163158137 19:15449914-15449936 CGCCGCCGCCTCCACCGCTCGGG + Exonic
1163355932 19:16810945-16810967 AGCCTCCGCCTCCTGGGTTCAGG + Intronic
1163577279 19:18118126-18118148 CGCCGCAGCCGCCCGAGGCCGGG - Intronic
1163680795 19:18681226-18681248 TGCCTCGGCCTCCCAAGTTCTGG + Intergenic
1163809144 19:19419596-19419618 AGCCTCCGCCTCCCAGGTTCAGG + Intronic
1164070838 19:21766910-21766932 AACCTCCGCCTCCCGGGTTCTGG - Intronic
1164212747 19:23114598-23114620 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1164241878 19:23396247-23396269 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1164662761 19:29992181-29992203 CGCCTCAGCCTCCCGAGTAGTGG + Intronic
1165083690 19:33327845-33327867 TGCCTCAGCCTCCCGAGTACTGG + Intergenic
1165212237 19:34245093-34245115 TGCCTCAGCCTCCCGAGTACTGG - Intergenic
1165303092 19:34984840-34984862 AGCCTCCGCCTCCTGGGTTCAGG - Intergenic
1165358396 19:35318450-35318472 AACCTCCGCCTCCCGAGTTCAGG + Intergenic
1165535288 19:36439082-36439104 AGCCTCCGCCTCCCACGTTCAGG - Intergenic
1165588447 19:36943686-36943708 TGCCTCCACCTCCCGAGTACTGG + Intronic
1165632096 19:37310373-37310395 CGCCGCGGCCTCCAAAGTGCTGG - Intergenic
1165672621 19:37692378-37692400 CGCAGCCGCCTCCCGACTGGAGG + Intronic
1165692402 19:37873811-37873833 AACCTCCGCCTCCCGAGTTCAGG - Intergenic
1165701336 19:37940660-37940682 AACCTCCGTCTCCCGAGTTCAGG + Intronic
1165752589 19:38269722-38269744 TGCCTCAGCCTCCCGAGTACTGG + Intronic
1165837156 19:38765798-38765820 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1165847781 19:38829700-38829722 TGCCTCAGCCTCCCGAGTACTGG - Intronic
1165928694 19:39342682-39342704 CGCCGCCGCCGCCCGCGGTTCGG - Intronic
1166001661 19:39881107-39881129 CGCCTCAGCCTCCCGAGTAGTGG - Intronic
1166004443 19:39897358-39897380 CGCCTCAGCCTCCCGAGTAGTGG - Intronic
1166009610 19:39932809-39932831 CACCTCAGCCTCCCGAGTACTGG + Intronic
1166058153 19:40306482-40306504 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1166083464 19:40459527-40459549 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1166182657 19:41119857-41119879 ACCCTCCGCCTCCCGGGTTCAGG - Intronic
1166195475 19:41203017-41203039 CAACTCCGCCTCCCGGGTTCAGG - Intronic
1166528653 19:43529024-43529046 AACCTCCACCTCCCGAGTTCAGG - Intronic
1166564133 19:43753540-43753562 GGCCTCTGCCTCCCGGGTTCAGG + Intronic
1166677883 19:44750378-44750400 AACCTCCGCCTCCCAAGTTCAGG + Intronic
1166729059 19:45047959-45047981 TGCCTCAGCCTCCCGAGTACAGG - Intronic
1166729122 19:45048410-45048432 TGCCTCAGCCTCCCGAGTACAGG - Intronic
1166768659 19:45267138-45267160 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1166794001 19:45415251-45415273 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1166826356 19:45611951-45611973 AGCCTCTGCCTCCCGGGTTCAGG + Intronic
1166883068 19:45940582-45940604 CGCCGCCGCCTCCGGCCTGCTGG - Exonic
1167302606 19:48687502-48687524 CACCTCCGCCTCCCGGGTTCAGG + Intergenic
1167495570 19:49816568-49816590 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1167578333 19:50328320-50328342 CGGCGCCGCCGCCCGCGTCCTGG + Exonic
1167587965 19:50385608-50385630 AACCTCCGCCTCCCGAGTTCAGG + Intronic
1167625911 19:50589021-50589043 AACCTCCGCCTCCCGGGTTCTGG - Intergenic
1168062639 19:53901601-53901623 CGCCTCAGCCTCCCAAGTGCTGG - Intronic
1168123076 19:54265631-54265653 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1168154608 19:54465715-54465737 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1168234172 19:55051542-55051564 TGCCTCAGCCTCCCGAGTACTGG + Intronic
1168601008 19:57718655-57718677 TGCCTCGGCCTCCCGAGTCCTGG - Intronic
1168623605 19:57898692-57898714 CGCCTCGGCCTCCCAAGTTCTGG - Intronic
1168641229 19:58033225-58033247 TGCCTCGGCCTCCCGAGTTCTGG + Intergenic
1168716171 19:58528810-58528832 AACCTCCGCCTCTCGAGTTCAGG - Intronic
925090108 2:1148426-1148448 CCCCGCAGCCTCCCCAGCTCTGG - Intronic
925379138 2:3412445-3412467 CGCCTCAGCCTCCTGAGTACTGG - Intronic
925418835 2:3693904-3693926 AACCTCCGCCTCCCGGGTTCAGG - Intronic
925771989 2:7290841-7290863 AGCCTCCGCCTCCCGTGTTCAGG - Intergenic
926266018 2:11321422-11321444 CGCCTCAGCCTCCCAAGTGCTGG + Intronic
926340116 2:11898381-11898403 CTCTGCCACCTCCCGGGTTCAGG - Intergenic
927176772 2:20415438-20415460 CGCCTCGGCCTCCCGAGGTGGGG + Intergenic
927215824 2:20667350-20667372 CGCCGCCGCCCCCTGGGCTCCGG - Exonic
927583704 2:24279812-24279834 AACCTCCGCCTCCCGGGTTCAGG + Intronic
927597146 2:24406876-24406898 ATCCTCCGCCTCCCGGGTTCAGG + Intergenic
927668866 2:25052112-25052134 AACCTCCGCCTCCCGGGTTCAGG - Intronic
927715395 2:25348688-25348710 AACCTCCGCCTCCCAAGTTCAGG + Intergenic
928152128 2:28841014-28841036 AGCCTCCGCCTCCCAGGTTCGGG + Intronic
928201488 2:29250220-29250242 AGCCTCCACCTCCAGAGTTCTGG - Intronic
928532326 2:32205337-32205359 AACCTCCGCCTCCCGGGTTCAGG - Intronic
928566730 2:32559932-32559954 AACCTCCGCCTCCCGGGTTCAGG - Intronic
928664823 2:33539750-33539772 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
928764301 2:34624151-34624173 CGCCTCAGCCTCCCAAGTGCTGG - Intergenic
928957639 2:36887386-36887408 AACCTCCGCCTCCCGGGTTCAGG - Intronic
929469232 2:42174897-42174919 AGCCTCCGCCTCCCGGGTTTAGG + Intronic
929515238 2:42600986-42601008 AACCTCCGCCTCCCGGGTTCAGG + Intronic
929663726 2:43816623-43816645 AGCCTCCGCCTCCCAGGTTCAGG + Intronic
929907849 2:46061936-46061958 AACCTCCGCCTCCCGGGTTCGGG + Intronic
930077807 2:47421349-47421371 AACCTCCGCCTCCCGGGTTCAGG + Intronic
930078954 2:47432166-47432188 AACCTCCGCCTCCCGGGTTCAGG - Intronic
930125332 2:47791926-47791948 AACCGCCACCTCCCGGGTTCAGG + Intronic
930195382 2:48504525-48504547 CGCCTCAGCCTCCCGAGTAGTGG - Intronic
930197804 2:48527068-48527090 AACCTCCGCCTCCTGAGTTCAGG + Intergenic
930824662 2:55684241-55684263 CGCCTCAGCCTCCCAAGTGCTGG - Intronic
931272530 2:60715466-60715488 CAACTCCGCCTCCCGGGTTCAGG - Intergenic
931349552 2:61475115-61475137 CAGCTCCGCCTCCCGGGTTCAGG + Intergenic
931382525 2:61766751-61766773 CGCCTCAGCCTCCCAAGTGCTGG - Intergenic
931382554 2:61766915-61766937 AACCTCCACCTCCCGAGTTCAGG - Intergenic
931391857 2:61851416-61851438 AACCTCCGCCTCCCGGGTTCAGG + Intronic
931398305 2:61907770-61907792 AACCTCCGCCTCCCGGGTTCAGG + Intronic
931618376 2:64184811-64184833 CGCCTCAGCCTCCCAAGTGCTGG - Intergenic
932186650 2:69702471-69702493 CACCTCCGCCTCCCAAGTGCTGG - Intronic
932201676 2:69833532-69833554 AACCTCCGCCTCCTGAGTTCAGG - Intronic
932204354 2:69865564-69865586 AACCTCTGCCTCCCGAGTTCAGG - Intronic
932230063 2:70075765-70075787 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
932335693 2:70930082-70930104 TGCCTCAGCCTCCCAAGTTCTGG - Intronic
932727168 2:74189490-74189512 CTCCTCCACCTCCCGAGCTCAGG + Intergenic
933428103 2:82139140-82139162 CGCCTCGGCCTCCCAAGTGCTGG + Intergenic
933755944 2:85638618-85638640 AACCTCCGCCTCCCGAGTTCAGG + Intronic
933772606 2:85753831-85753853 CGCCACCGCCTCCCCAGCCCGGG - Intronic
933845851 2:86326628-86326650 AACCTCCGCCTCCCGGGTTCAGG - Intronic
933854973 2:86404141-86404163 AGCCTCCGCCTCCTGGGTTCAGG - Intergenic
933910313 2:86934917-86934939 AACCTCCGCCTCCCGAGTTCGGG + Intronic
933912033 2:86949845-86949867 CACTGCTGCCTCCCGGGTTCAGG + Intronic
933912868 2:86959606-86959628 AACCTCCGCCTCCCGGGTTCAGG + Intronic
934010127 2:87810284-87810306 AACCTCCGCCTCCCGGGTTCAGG - Intronic
934010961 2:87820052-87820074 CACTGCTGCCTCCCGGGTTCAGG - Intronic
934022414 2:87968492-87968514 AACCTCCGCCTCCCGAGTTCGGG - Intergenic
934094980 2:88593026-88593048 TGCCTCTGCCTCCCGAGTACCGG - Intronic
934152675 2:89163002-89163024 AGCCTCCGCCTCCCAGGTTCAGG - Intergenic
934214566 2:90018924-90018946 AGCCTCCGCCTCCCAGGTTCAGG + Intergenic
934296795 2:91748939-91748961 CGCCGCCGCCTCCAGCGCGCGGG + Intergenic
934614451 2:95762609-95762631 TGCAGTCGCCTCCCAAGTTCAGG - Intergenic
934646454 2:96061890-96061912 TGCAGTCGCCTCCCAAGTTCAGG + Intergenic
934668604 2:96192281-96192303 CACCCCCTCCTCCCTAGTTCAGG + Intronic
934724904 2:96609867-96609889 AACCTCCGCCTCCTGAGTTCTGG - Intronic
934982400 2:98854165-98854187 CGCCTCAGCCTCCCGAATACTGG - Intronic
935077759 2:99762236-99762258 CGCCTCAGCCTCCTGAGTCCTGG + Intronic
935162632 2:100542479-100542501 CGCCTCGGCCTCCCAAGTGCTGG - Intergenic
935244556 2:101206856-101206878 AACCTCCGCCTCCCGGGTTCAGG - Intronic
935330932 2:101977521-101977543 CGCCTCAGCCTCCCAAGTGCTGG - Intergenic
935773695 2:106451005-106451027 AACCTCCGCCTCCCGGGTTCAGG - Intronic
935829510 2:106986284-106986306 TGCCTCAGCCTCCCAAGTTCTGG + Intergenic
935963120 2:108446559-108446581 CGCCTCAGCCTCCCGAGTAGCGG - Intergenic
936066793 2:109338637-109338659 AACCTCTGCCTCCCGAGTTCAGG + Intronic
936122758 2:109760663-109760685 CGCCGCCGCCGCCGAAGCTCGGG - Intergenic
936128151 2:109810054-109810076 AACCTCCGCCTCCCGGGTTCAGG + Intronic
936216546 2:110561431-110561453 AACCTCCGCCTCCCGGGTTCAGG - Intronic
936221935 2:110610810-110610832 CGCCGCCGCCGCCGAAGCTCGGG + Intergenic
936379523 2:111972110-111972132 CACCTCTGCCTCCCGGGTTCAGG + Intronic
936381372 2:111989468-111989490 TGCCTCAGCCTCCCGAGTACTGG + Intronic
936413875 2:112286517-112286539 AACCTCCGCCTCCCGAGTTCGGG + Intronic
936419642 2:112350861-112350883 CGCCACCCCCTCCAGAGTTGTGG - Intergenic
936425686 2:112416006-112416028 AACCTCCGCCTCCCGGGTTCAGG - Intronic
936580922 2:113699841-113699863 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
936716370 2:115191629-115191651 CGCCGCCCCCTCCCAAGTCATGG - Intronic
936875652 2:117185987-117186009 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
937193105 2:120123737-120123759 AGCCTCCACCTCCCGAGTTCAGG + Intronic
937297137 2:120816275-120816297 AACCTCCGCCTCCCGGGTTCAGG + Intronic
937666469 2:124493586-124493608 TGCCTCTGCCTCCCAAGTTCTGG + Intronic
937874818 2:126815697-126815719 CGCCTCCGCCTCCCAAGTCCTGG - Intergenic
938038145 2:128053527-128053549 CGCCGCCGCCGCCCCAATTCTGG + Intergenic
938042806 2:128090262-128090284 CGCCTCGGCCTCCCAAGTGCTGG - Intergenic
938073095 2:128318634-128318656 CTCCGCCGCCGCCCGCGCTCCGG + Intergenic
938073211 2:128318981-128319003 CGGCCCCGCCTCCGGAGTGCCGG + Intergenic
938302264 2:130225031-130225053 CGCCTCAGCCTCCTGAGTACAGG + Intergenic
938454416 2:131449237-131449259 CGCCTCAGCCTCCTGAGTACAGG - Intergenic
939481040 2:142747409-142747431 CGCCCCAGCCTCCCGAGTGCTGG - Intergenic
939867960 2:147495777-147495799 AACCACCGCCTCCCGGGTTCAGG - Intergenic
940218414 2:151324902-151324924 AGCCTCCACCTCCCGGGTTCGGG - Intergenic
940332678 2:152491867-152491889 AACCTCCGCCTCCCGAGTTCAGG - Intronic
940342410 2:152595400-152595422 AACCTCCACCTCCCGAGTTCAGG + Intronic
940570070 2:155419856-155419878 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
941133732 2:161686962-161686984 AACCTCCGCCTCCCGGGTTCAGG + Intronic
941764487 2:169281634-169281656 AACCTCCGCCTCCCGGGTTCAGG - Intronic
941909996 2:170755570-170755592 AACCTCCGCCTCCCGAGTTCAGG - Intergenic
943572591 2:189591081-189591103 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
944108618 2:196107120-196107142 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
944173362 2:196802867-196802889 AGCCTCCGCCTCCGGGGTTCAGG + Intergenic
944248998 2:197562209-197562231 CGCCTCGGCCTCTCGAGTGCTGG + Intergenic
944249457 2:197566893-197566915 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
944596898 2:201269186-201269208 CACCTCAGCCTCCCAAGTTCTGG + Intronic
944816697 2:203384914-203384936 AACCTCCGCCTCCCGGGTTCAGG + Intronic
944990166 2:205226287-205226309 CGCCTTGGCCTCCCAAGTTCTGG + Intronic
945220112 2:207474616-207474638 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
945245201 2:207711510-207711532 CGCCGCCGCCTACCGACTGAAGG - Intergenic
945289216 2:208111134-208111156 AACCTCCACCTCCCGAGTTCAGG - Intergenic
945972894 2:216247468-216247490 CACCTCCACCTCCCGGGTTCAGG + Intergenic
946250723 2:218410350-218410372 TGCCTCAGCCTCCCGAGTACTGG + Intergenic
946266705 2:218549711-218549733 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
946323578 2:218969617-218969639 TGCCTCAGCCTCCCGAGTACTGG + Intergenic
947255808 2:228162778-228162800 CACCTCCGCCTCCCGGGTTCAGG + Intronic
947512499 2:230769842-230769864 CACCTCAGCCTCCCGAGTCCCGG - Intronic
947578864 2:231298850-231298872 AGCCTCCGCCTCCCAGGTTCAGG - Intronic
947599585 2:231437796-231437818 AGCCTCTGCCTCCCGGGTTCAGG - Intergenic
947631958 2:231659666-231659688 TGCCTCAGCCTCCCGAGTACTGG + Intergenic
947789199 2:232853389-232853411 TGCCTCAGCCTCCCGAGTGCTGG + Intronic
947836838 2:233181845-233181867 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
947919015 2:233853960-233853982 CGCCGCCTCCTCCCGGGTCTGGG - Intronic
948046982 2:234952295-234952317 TGCCACCGCCGCCTGAGTTCGGG + Intronic
948929629 2:241123702-241123724 CGCCTCAGCCTCCCGAGTAGTGG - Intronic
949004297 2:241636846-241636868 CGCCCCCGCCCCCCGCGTTCGGG + Intronic
1168774572 20:437030-437052 AACCTCCGCCTCCCAAGTTCAGG - Exonic
1169225520 20:3854171-3854193 CGCCTCGGCCTCCCAAGTTTGGG - Intronic
1169329023 20:4702087-4702109 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1170247676 20:14241032-14241054 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1170644519 20:18185448-18185470 CACCTCAGCCTCCCGAGTGCTGG + Intronic
1171453905 20:25255813-25255835 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1171963610 20:31513713-31513735 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1172023515 20:31932746-31932768 CGCCTCGGCCTCCAGAGTGCTGG - Intronic
1172037308 20:32019118-32019140 CGCCGCCGCCTCCCCCGGCCCGG - Exonic
1172103700 20:32502509-32502531 AGCCTCCGCCTCCCGGATTCAGG - Intronic
1172164094 20:32888305-32888327 AGCCTCTGCCTCCCGGGTTCAGG + Intronic
1172242409 20:33422190-33422212 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
1172318248 20:33973661-33973683 CGCCTCGGCCTCCCGAGGTGCGG + Intergenic
1172418986 20:34797810-34797832 AGCTGCCGCCTCCCAGGTTCAGG - Intronic
1172464301 20:35144413-35144435 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1172549797 20:35789934-35789956 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1172688511 20:36774637-36774659 AACCTCCGCCTCCCGGGTTCGGG + Intergenic
1172710352 20:36917567-36917589 AACCTCCGCCTCCTGAGTTCAGG - Intronic
1172928267 20:38561075-38561097 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
1172971486 20:38876052-38876074 CAACTCCGCCTCCCGGGTTCGGG + Intronic
1174190026 20:48733999-48734021 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1174214331 20:48904453-48904475 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1174251226 20:49221041-49221063 AGCCTCCCCCTCCCGGGTTCAGG + Intronic
1174296238 20:49547148-49547170 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1174806352 20:53607368-53607390 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1174808393 20:53624806-53624828 TGCCTCAGCCTCCCGAGTACTGG - Intergenic
1174963620 20:55185659-55185681 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1175201566 20:57281411-57281433 CGCCTCAGCCTCCCAAGTGCTGG - Intergenic
1176004328 20:62852052-62852074 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1176079261 20:63263592-63263614 AACCGCCGCCGCCCGGGTTCAGG - Intronic
1176136533 20:63524799-63524821 AGCCTCCGCCTCCCGGGCTCAGG - Intergenic
1176952668 21:15064961-15064983 CGCCGCCGCCTCCCGAGTTCGGG + Exonic
1177796198 21:25780862-25780884 CGCCTCGGCCTCCCAAGTGCTGG - Intergenic
1178359439 21:31935898-31935920 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1178890761 21:36519460-36519482 CGCCTCAGCCTCCCAAGTGCTGG - Intronic
1178992482 21:37367203-37367225 CGCCGCCGCCGCCCGGGCCCCGG + Intronic
1179075936 21:38121707-38121729 AGCCTCCGCCTCCTAAGTTCAGG + Intronic
1179251784 21:39676772-39676794 CGCCTCGGCCTCCCAAGTGCTGG - Intergenic
1179511999 21:41879343-41879365 CGCCGCCGCCCCCCGGCTTCCGG - Exonic
1179661719 21:42880046-42880068 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1179840361 21:44068680-44068702 AGCCTCCGCCTCCAGGGTTCAGG + Intronic
1180202984 21:46238016-46238038 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1180235889 21:46459163-46459185 CGCCGCTGCCTGCCGAGGTGCGG + Exonic
1180285533 22:10741780-10741802 CAGCGGCGCCTCCCGAGTCCCGG + Intergenic
1180649974 22:17369566-17369588 CGCAGCCGCCTCAGTAGTTCGGG + Exonic
1180695352 22:17748424-17748446 AGGCTCCGCCTCCCGGGTTCAGG - Intronic
1181098766 22:20524701-20524723 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1181321746 22:22012619-22012641 CGCCTCAGCCTCCCAAGTGCTGG - Intergenic
1181348571 22:22238990-22239012 AGTCTCCGCCTCCCGGGTTCAGG + Intergenic
1181502108 22:23321922-23321944 AAGCTCCGCCTCCCGAGTTCAGG + Intergenic
1181587857 22:23863699-23863721 CTCCGCCCCGTCCCGAGCTCAGG + Intronic
1181721152 22:24775580-24775602 AGCCTTCGCCTCCCGGGTTCAGG + Intergenic
1181785882 22:25226753-25226775 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1181799484 22:25335015-25335037 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1182136524 22:27909313-27909335 CACCTCAGCCTCCCAAGTTCTGG + Intronic
1182276301 22:29190813-29190835 TGCCTCAGCCTCCCGAGTGCTGG - Intergenic
1183081850 22:35461909-35461931 TGCCTCAGCCTCCCGAGTACTGG + Intergenic
1183108159 22:35629333-35629355 AACCTCCGCCTCCCGAGTTCAGG - Intronic
1183226370 22:36552979-36553001 CGCCTTGGCCTCCCGAGTGCTGG + Intergenic
1183441233 22:37824317-37824339 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1183459296 22:37940339-37940361 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1183502331 22:38188396-38188418 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1183524957 22:38317366-38317388 CGCCGCCGCCTCCCTCCTCCCGG + Exonic
1183801741 22:40171940-40171962 AGCCTCCGCCTCCTGGGTTCAGG + Intronic
1183959135 22:41400645-41400667 CGCCTCGGCCTCCCGAACTCAGG + Intergenic
1183989613 22:41589371-41589393 CGCCCCCGCCTCCTGAGCTGGGG - Intronic
1184002582 22:41686056-41686078 CGCCTCAGCCTCCCAATTTCTGG + Intronic
1184023315 22:41835390-41835412 AACCTCCACCTCCCGAGTTCAGG + Intronic
1184228242 22:43143054-43143076 CGCCGCCGCCCGCCGCGTGCTGG - Exonic
1184628802 22:45759428-45759450 AACCTCTGCCTCCCGAGTTCAGG - Intronic
1185116213 22:48939768-48939790 CGCCCCCGCCCCCCGAGGCCGGG + Intergenic
1185242057 22:49751930-49751952 GGCCTGCGCCTCCCGGGTTCTGG - Intergenic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
1185302305 22:50088332-50088354 CGCCTTGGCCTCCCGAGTGCTGG - Intergenic
1185303211 22:50094972-50094994 CGCCTCAGCCTCCCGAGTGCTGG - Intronic
949309009 3:2674674-2674696 AACCTCCGCCTCCCGGGTTCAGG - Intronic
949311535 3:2704181-2704203 TGCCTCAGCCTCCCGAGTACTGG - Intronic
950004489 3:9682943-9682965 CGCCCCCGCCCCCCGAGTAGGGG + Intronic
950009005 3:9709192-9709214 AACCTCCGCCTCCCGGGTTCAGG - Intronic
950020321 3:9782707-9782729 AACCTCCGCCTCCCGGGTTCAGG - Intronic
950066085 3:10113019-10113041 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
950222815 3:11209338-11209360 CGCCTCAGCCTCCCCAGTACTGG + Intronic
950342831 3:12262568-12262590 AGCCTCTGCCTCCCGGGTTCAGG - Intergenic
950729784 3:14947603-14947625 CGCCGCCGCCGCCCGCGCGCTGG - Intronic
950908245 3:16558574-16558596 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
951080304 3:18444729-18444751 CGCCGCCGCCGCCGGAGCTGCGG + Intronic
951552931 3:23893681-23893703 TGCCGCAGCCTCCCAAGTACAGG - Intronic
951554192 3:23904081-23904103 AGCCTCCGCATCCTGAGTTCAGG - Intronic
951756265 3:26094896-26094918 TGCCTCAGCCTCCCGAGTACTGG - Intergenic
952347350 3:32501106-32501128 AACCTCCGCCTCCCGGGTTCAGG - Intronic
952404523 3:32993614-32993636 AGCCTCCGCCTCCCGCTTTCAGG + Intergenic
952592936 3:34979266-34979288 TGCCTCAGCCTCCCGAGTACTGG - Intergenic
952840501 3:37641504-37641526 TGCGGCTGGCTCCCGAGTTCTGG - Intronic
952888276 3:38024912-38024934 CGGCCCCGCCTCCTGGGTTCTGG - Intronic
953437265 3:42888082-42888104 AACCTCCGCCTCCCGGGTTCAGG + Intronic
954037428 3:47859013-47859035 TGCCTCAGCCTCCCGAGTACTGG - Intronic
954122760 3:48509498-48509520 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
954188871 3:48941965-48941987 ACCCTCCGCCCCCCGAGTTCAGG + Intronic
954252788 3:49381321-49381343 AGCCTCTGCCTCCTGAGTTCAGG - Intronic
954260918 3:49438265-49438287 AACCTCCGCCTCCCGAGTTCAGG + Intergenic
954341332 3:49956415-49956437 AACCTCCGCCTCCCGGGTTCAGG + Intronic
954571035 3:51641252-51641274 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
954585940 3:51736941-51736963 TGCCTCAGCCTCCCGAGTGCTGG + Intergenic
954682682 3:52354382-52354404 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
955184528 3:56702335-56702357 CGCCTCAGCCTCCCAAGTCCTGG - Intergenic
955304153 3:57813175-57813197 AACCTCCACCTCCCGAGTTCAGG + Intronic
955326283 3:58011159-58011181 CGCCTCGGCCTCCCAAGTGCGGG + Intronic
955739952 3:62080147-62080169 AACCTCCGCCTCCCGGGTTCAGG + Intronic
956139548 3:66131845-66131867 CAACTCCGCCTCCCGGGTTCAGG + Intergenic
956813846 3:72889985-72890007 AACCGCTGCCTCCCGGGTTCAGG + Intronic
956820481 3:72949591-72949613 AACCTCCGCCTCCCGGGTTCAGG + Intronic
957467287 3:80609772-80609794 AAGCTCCGCCTCCCGAGTTCAGG - Intergenic
958948330 3:100389956-100389978 AACCTCCGCCTCCTGAGTTCAGG - Intronic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
959569896 3:107871856-107871878 TACCTCCGCCTCCCGGGTTCAGG - Intergenic
959716023 3:109433263-109433285 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
959761410 3:109970083-109970105 AGTCTCCGCCTCCTGAGTTCAGG + Intergenic
959827676 3:110819065-110819087 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
959921671 3:111875228-111875250 AACCTCCGCCTCCCGGGTTCAGG + Intronic
959974551 3:112443971-112443993 CAGCTCCGCCTCCCGGGTTCAGG - Intergenic
960576796 3:119238183-119238205 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
961062204 3:123839011-123839033 CACCTCCACCTCCCAAGTTCAGG - Intronic
961389209 3:126542440-126542462 AGCCGCCGCCTCCCGCGACCTGG + Exonic
961943025 3:130656791-130656813 CTCAGCCCCCTCCCGAGTTTGGG - Intronic
962123299 3:132587010-132587032 AGCCTCTGCCTCCCGGGTTCAGG - Intronic
962551034 3:136491908-136491930 AGCCCCCGCCTCCTGGGTTCAGG - Intronic
962590161 3:136881464-136881486 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
962721932 3:138184111-138184133 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
962815998 3:139000915-139000937 CGCCTCAGCCTCCCAAGTGCTGG + Intergenic
962972744 3:140419366-140419388 CGCCTCAGCCTCCCAAGTACTGG - Intronic
963133246 3:141877030-141877052 CGCCGCCGCCGCCCGGGTTAGGG - Intronic
963478478 3:145836794-145836816 CGCCTCAGCCTCCAAAGTTCTGG + Intergenic
963602550 3:147390824-147390846 CGCCGCCGCCTCCGGTATTAGGG - Intronic
963871575 3:150420967-150420989 CGCCTCAGCCTCCCGAGTAGCGG - Intronic
963887549 3:150599026-150599048 CGCCTCGGCCTCCCAAGTACTGG + Intronic
963958716 3:151284688-151284710 AACCTCCGCCTCCCGGGTTCTGG + Intronic
964215633 3:154278556-154278578 AGCCTCCGCCTCCCGGGTTCCGG + Intronic
964489033 3:157215196-157215218 AGCCTCCGCCTCCCTAGTTCCGG + Intergenic
964722116 3:159778061-159778083 TGCACCCGCCTCCCGGGTTCAGG + Intronic
964797120 3:160511037-160511059 CGCCTCAGCCTCCCAAGTGCTGG + Intronic
964938502 3:162124050-162124072 AAGCTCCGCCTCCCGAGTTCAGG - Intergenic
965477113 3:169170323-169170345 AACCTCCGCCTCCCGGGTTCAGG - Intronic
965922145 3:173929951-173929973 TGCCTCAGCCTCCCAAGTTCTGG + Intronic
966082929 3:176027756-176027778 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
966358199 3:179104586-179104608 CGCCTCAGCCTCCCAAGTGCTGG - Intergenic
966818905 3:183909757-183909779 CGCCTCGGCCTCCCAAGTGCTGG - Intergenic
967153666 3:186673183-186673205 AACCTCCGCCTCCCGGGTTCAGG + Intronic
967202753 3:187087908-187087930 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
967207488 3:187137426-187137448 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
967685281 3:192409913-192409935 CGCCGCCGCCTCCCCAGGCCCGG + Intronic
967793928 3:193578043-193578065 CGCCTCAGCCTCCCAAGTGCTGG - Intronic
967924184 3:194633377-194633399 CGCCGCCGCCGCCCGCGCCCGGG - Exonic
968020183 3:195378777-195378799 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
968162475 3:196438364-196438386 AAGCTCCGCCTCCCGAGTTCAGG + Intergenic
968200763 3:196753058-196753080 AACTTCCGCCTCCCGAGTTCAGG + Intronic
968246813 3:197158550-197158572 AGCCTCCACCTCCCGGGTTCAGG - Intronic
968461444 4:727320-727342 AACCTCCGCCTCCCGGGTTCAGG + Intronic
968596882 4:1490311-1490333 CGACGCCGCCTCCCGCCTCCCGG + Intergenic
968630143 4:1646180-1646202 AACCTCCGCCTCCCGGGTTCAGG + Intronic
968783340 4:2600011-2600033 TGCCTCAGCCTCCCGAGTACCGG + Intronic
968839119 4:2988487-2988509 AGCCTCTGCCTCCCGGGTTCAGG - Intronic
969424258 4:7114959-7114981 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
969426238 4:7125879-7125901 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
969965944 4:10995428-10995450 TGCCTCAGCCTCCCGAGTACCGG - Intergenic
970333856 4:15011347-15011369 CGCCTCGGCCTCCAGAGTGCTGG + Intronic
970779106 4:19713920-19713942 TGCCTCAGCCTCCCGAGTACCGG - Intergenic
970921139 4:21396472-21396494 AACCTCCGCCTCCCGGGTTCAGG - Intronic
971434323 4:26604265-26604287 TGCCTCAGCCTCCCGAGTACTGG + Intronic
971706571 4:30051011-30051033 CGCCTCAGCCTCCCAAGTGCTGG - Intergenic
971910555 4:32791259-32791281 CGTCGCCTCCTGCCAAGTTCGGG - Intergenic
972433849 4:39012689-39012711 CGCCTCAGCCTCCCAAGTGCTGG - Intronic
972628114 4:40820413-40820435 CGCCTCAGCCTCCCAAGTGCTGG - Intronic
972694780 4:41434596-41434618 CACCTCCACCTCCCAAGTTCAGG + Intronic
973301240 4:48587623-48587645 AACCTCCGCCTCCCGGGTTCAGG + Intronic
973704834 4:53571266-53571288 TGCCTCCGCCTCCCAAGTGCTGG + Intronic
973764614 4:54151839-54151861 AATCTCCGCCTCCCGAGTTCAGG + Intronic
974316615 4:60290581-60290603 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
974498926 4:62672309-62672331 TGCCTCAGCCTCCCGAGTGCTGG + Intergenic
974556319 4:63453500-63453522 AACCTCCACCTCCCGAGTTCAGG + Intergenic
974831018 4:67189677-67189699 CGCCTCAGCCTCCCAAGTGCTGG + Intergenic
975334519 4:73160330-73160352 CGCCTCAGCCTCCCGAGTAGCGG + Intronic
975758132 4:77591467-77591489 AAGCTCCGCCTCCCGAGTTCAGG - Intronic
975986117 4:80202701-80202723 CGCCGCCGCCGCCAGCGTCCTGG - Exonic
976188475 4:82466742-82466764 AGCCTCCCCCTCCCGGGTTCAGG + Intergenic
976606432 4:86987702-86987724 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
976644941 4:87377366-87377388 AACCTCCGCCTCCCGGGTTCAGG - Intronic
976768839 4:88628923-88628945 CGCCTCGGCCTCCCAAGTCCCGG - Intronic
976813800 4:89124189-89124211 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
977173928 4:93796623-93796645 AACCTCCACCTCCCGAGTTCAGG + Intergenic
977253149 4:94710995-94711017 CGCCTCAGCCTCCCAAGTGCTGG - Intergenic
977593715 4:98854450-98854472 AACCTCTGCCTCCCGAGTTCAGG - Intergenic
977596273 4:98884620-98884642 AACCTCCGCCTCCCGGGTTCAGG - Intronic
977620233 4:99127745-99127767 CTCCTCCTCCTCCCGGGTTCAGG - Intronic
977626517 4:99194402-99194424 CGCCTCTGCCTCCTGGGTTCAGG + Intergenic
977799020 4:101203411-101203433 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
978463926 4:108987455-108987477 AACCTCCGCCTCCCGGGTTCAGG + Intronic
978516406 4:109573337-109573359 TGCCGCAGCCTCCCGAGTAGTGG - Intronic
978572525 4:110154335-110154357 AGCCTCCGCCTCCCAGGTTCAGG + Intronic
979107424 4:116705579-116705601 TGCCGCAGCCTCCCGACTTCAGG - Intergenic
979832037 4:125315643-125315665 CGCCGCCGCCGCCCCTGTTGCGG - Intergenic
980046166 4:127991306-127991328 ACCCTCCGCCTCCCGGGTTCAGG + Intronic
980052933 4:128055900-128055922 AACCTCTGCCTCCCGAGTTCAGG - Intergenic
980120897 4:128726879-128726901 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
980135948 4:128858682-128858704 AACCTCCGCCTCCCGGGTTCAGG + Intronic
980812696 4:137903193-137903215 CGCCTCGGCCTCCCAAGTACTGG + Intergenic
980912520 4:139006488-139006510 CACCTCCGCCTCCCTGGTTCAGG - Intergenic
981728402 4:147871986-147872008 CACCTCAGCCTCCCGAGTACAGG - Intronic
981782499 4:148444157-148444179 CGCCGCCGCCTCGCGTGCCCAGG - Intronic
982247705 4:153370599-153370621 AACCTCCGCCTCCCGGGTTCAGG + Intronic
983077691 4:163344572-163344594 CGCAGCTGCCTCCCGGGCTCGGG - Exonic
983205578 4:164907148-164907170 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
983632611 4:169864531-169864553 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
983710746 4:170712785-170712807 TGCCTCAGCCTCCCGAGTACTGG - Intergenic
983783069 4:171697224-171697246 AACCTCTGCCTCCCGAGTTCAGG - Intergenic
983897482 4:173097545-173097567 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
984100549 4:175479171-175479193 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
984830393 4:183967282-183967304 AACCTCCGCCTCCCGGGTTCAGG - Intronic
984897779 4:184557167-184557189 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
986016701 5:3763830-3763852 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
986320002 5:6622763-6622785 AACCTCCGCCTCCTGAGTTCAGG - Intronic
986746058 5:10746409-10746431 AACCTCCGCCTCCTGAGTTCAGG + Intronic
986802600 5:11277778-11277800 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
987235977 5:15942076-15942098 CGCCTCGGCCTCCCAAGTTCTGG - Intergenic
987575542 5:19723793-19723815 AACCTCCACCTCCCGAGTTCAGG + Intronic
988241097 5:28610242-28610264 AGCCTCCGCCTCCCAGGTTCAGG + Intergenic
988661048 5:33268948-33268970 TGCCTCAGCCTCCCGAGTTTTGG - Intergenic
989037567 5:37191587-37191609 AGCCTCTGCCTCCCGGGTTCAGG - Intronic
989038522 5:37201070-37201092 CGCCTTGGCCTCCCAAGTTCTGG + Intronic
989316814 5:40090707-40090729 TGCCTCAGCCTCCCGAGTGCTGG + Intergenic
989323353 5:40162302-40162324 TGCCTCAGCCTCCCGAGTACTGG + Intergenic
989764927 5:45071050-45071072 TGCCTCAGCCTCCCGAGTACTGG - Intergenic
990389104 5:55300422-55300444 CGCCTCCGCGTCCCAAGTGCTGG - Intronic
990425819 5:55687810-55687832 GGCCTCAGCCTCCCGAGTGCTGG + Intronic
990964623 5:61431661-61431683 AAGCTCCGCCTCCCGAGTTCAGG - Intronic
991082759 5:62619145-62619167 AGCCTCCGCCTCCTGGGTTCAGG - Intronic
991372339 5:65932255-65932277 AACCTCCACCTCCCGAGTTCAGG - Intronic
991708749 5:69385518-69385540 CGCCTTGGCCTCCCGAGTGCTGG + Intronic
992152034 5:73914476-73914498 AACCTCCACCTCCCGAGTTCAGG + Intronic
992866339 5:80960568-80960590 CGCCGCGGCCTCCCGAAAGCGGG + Intergenic
993727559 5:91385691-91385713 GGCCTCTGCCTCCCGGGTTCAGG + Intergenic
993918213 5:93767910-93767932 AAGCTCCGCCTCCCGAGTTCAGG - Intronic
994212188 5:97099586-97099608 TGCCGCAGCCTCCCAAGTGCTGG - Intronic
996549584 5:124716059-124716081 CAGCTCCGCCTCCCGGGTTCAGG - Intronic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997279284 5:132628763-132628785 AACCTCCGCCTCCCGGGTTCAGG - Intronic
997334765 5:133099209-133099231 AACCTCCGCCTCCTGAGTTCAGG + Intronic
997534742 5:134610483-134610505 CACCTCCACCTCCCGGGTTCAGG - Intronic
997565494 5:134883038-134883060 CGCCTCAGCCTCCCAAATTCTGG - Intronic
997682081 5:135763984-135764006 TGCCTCAGCCTCCCGAGTGCGGG + Intergenic
997794246 5:136792328-136792350 GGCCTCTGCCTCCCGGGTTCAGG - Intergenic
998081019 5:139274809-139274831 TGCCTCAGCCTCCCGACTTCAGG - Intronic
998106962 5:139474846-139474868 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
998233151 5:140374466-140374488 AACCTCCGCCTCCCGGGTTCAGG - Intronic
998264036 5:140653684-140653706 AGCCTCCGCCTCCCATGTTCAGG + Intronic
998271413 5:140709991-140710013 AGCCTCCACCTCCCGGGTTCAGG - Intergenic
998552528 5:143091147-143091169 CGCCGCCCCCTCCAGAGTCGTGG - Intronic
998554124 5:143106552-143106574 AACCTCCGCCTCCCGGGTTCAGG + Intronic
998680402 5:144460521-144460543 AGCCTCTGCCTCCTGAGTTCAGG + Intronic
998862078 5:146454117-146454139 AACCTCCGCCTCCCGGGTTCAGG - Intronic
998938714 5:147257589-147257611 CGCTGCCCCCTCCAGAGTTGTGG - Intronic
999681348 5:154063084-154063106 AACCTCCGCCTCCCGGGTTCAGG - Intronic
999764866 5:154732082-154732104 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1000073259 5:157761079-157761101 AGCCTCTGCCTCCCGGGTTCAGG - Intergenic
1000490011 5:161900867-161900889 AAACTCCGCCTCCCGAGTTCAGG - Intergenic
1000904466 5:166947405-166947427 AGCCTCCACCTCCCGGGTTCAGG - Intergenic
1000953797 5:167517936-167517958 TGCCTCCGCCTCCCAAGTGCTGG - Intronic
1001215770 5:169854431-169854453 TGCCTCAGCCTCCCAAGTTCTGG + Intronic
1001385228 5:171333184-171333206 AACCTCCGCCTCCTGAGTTCAGG + Intergenic
1001421584 5:171591763-171591785 AACCTCTGCCTCCCGAGTTCAGG + Intergenic
1001496026 5:172188227-172188249 CGCCGCCGCCTGCGCGGTTCCGG - Exonic
1002127897 5:177060437-177060459 CACCTCCGCCTCCTGGGTTCAGG - Intronic
1002146363 5:177185347-177185369 AGCCTCCGCCTCCCAAGTGCTGG - Intronic
1002293787 5:178217300-178217322 AGCTGCCGCCTCCCAGGTTCAGG + Intronic
1002364204 5:178697370-178697392 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1002600696 5:180352796-180352818 GGCCGGCGCATCCCGAGTGCGGG - Intronic
1003071885 6:2951302-2951324 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
1003210894 6:4065696-4065718 CGCCTCCGCCTCCTGACCTCAGG + Intronic
1003645535 6:7910648-7910670 CGCCGCCGCCTCCTGGGCCCGGG + Exonic
1003656381 6:8014353-8014375 AACCTCCGCCTCCTGAGTTCAGG + Exonic
1003883309 6:10497858-10497880 TGCCTCAGCCTCCCGAGTGCTGG - Intronic
1004023825 6:11799556-11799578 AGCATCCGCCTCCCGGGTTCAGG - Intronic
1004606504 6:17200285-17200307 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1004627938 6:17393997-17394019 TGCCCCCGCCTCCCCAGCTCCGG + Intronic
1005189290 6:23201563-23201585 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1005499156 6:26414798-26414820 TGCCTCAGCCTCCCGAGTACTGG + Exonic
1005580620 6:27230969-27230991 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1005585217 6:27269821-27269843 CGCCTCTGCCTCCCAAGTGCTGG - Intergenic
1005732526 6:28711960-28711982 AGCCTCTGCCTCCCGGGTTCAGG - Intergenic
1005891801 6:30146523-30146545 TGCCTCAGCCTCCCGAGTACTGG + Intronic
1006331417 6:33393826-33393848 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1006349178 6:33508355-33508377 ACCCTCCGCCTCCCGGGTTCAGG - Intergenic
1006758457 6:36438535-36438557 CGCCTCAGCCTCCCGAGTACCGG + Intronic
1006763379 6:36483459-36483481 CGCCTCAGCCTCCCAAGTGCTGG + Intronic
1006778877 6:36618245-36618267 TGCCTCAGCCTCCCGAGTACTGG - Intergenic
1006856907 6:37140123-37140145 AGCCTCCGCCTCCCGGGTTCAGG - Intergenic
1007504892 6:42328085-42328107 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1007676381 6:43599068-43599090 AGCCTCCGCCTCCCGGGTTCAGG + Intronic
1007798982 6:44375726-44375748 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1007885797 6:45228728-45228750 AGCCGCCGCCCCCAGAGTTCAGG + Intronic
1008073168 6:47118050-47118072 TGCCTCAGCCTCCCGAGTACTGG - Intergenic
1008312823 6:49997588-49997610 AAGCTCCGCCTCCCGAGTTCAGG - Intergenic
1008521009 6:52362323-52362345 CGTCCCCGCCTCCCGAGCTCGGG - Intronic
1008607011 6:53150370-53150392 AACCTCTGCCTCCCGAGTTCAGG + Intergenic
1009010306 6:57834390-57834412 CGCCTCGGCCTCCCAAGTGCTGG + Intergenic
1009435682 6:63615456-63615478 CGCCTCGGCCTCCCAAGTGCTGG + Intergenic
1010249139 6:73690647-73690669 CGCCTCGGCCTCCCAAGTGCTGG + Intergenic
1010698400 6:79008072-79008094 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1011122314 6:83966607-83966629 AACCTCCGCCTCCCGGGTTCAGG - Exonic
1011155599 6:84327222-84327244 AACCTCCGCCTCCCGGGTTCCGG + Intergenic
1011287158 6:85736994-85737016 AGCCTCTGCCTCCCGGGTTCTGG - Intergenic
1011610784 6:89148060-89148082 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1011685260 6:89818725-89818747 ACCCTCCGCCTCCCGGGTTCAGG - Intronic
1011751229 6:90457223-90457245 CGCCGTGGCCTCCCAAGTGCTGG - Intergenic
1012003236 6:93680757-93680779 CGCCTCGGCCTCCCAAGTGCTGG + Intergenic
1013133025 6:107253283-107253305 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1013743126 6:113312802-113312824 CGCCTCAGCCTCCCAAGTGCTGG + Intergenic
1014233275 6:118928160-118928182 CACCTCAGCCTCCCCAGTTCTGG - Intronic
1014599875 6:123398084-123398106 AACCTCCGCCTCCGGAGTTCAGG + Intronic
1014655926 6:124103970-124103992 CGCCTCAGCCTCCTGAGTACTGG - Intronic
1015637656 6:135294242-135294264 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1015690279 6:135914604-135914626 CGCCTCAGCCTCCCGAGAGCTGG + Intronic
1016055227 6:139571590-139571612 CGCCTCAGCCTCCCGACTACAGG + Intergenic
1017185053 6:151592276-151592298 AGCCTCCGCCTCCCAGGTTCCGG - Intronic
1017311559 6:152982713-152982735 CGCTGCCGCCGCCCGAGGCCGGG + Intronic
1017394737 6:153984545-153984567 CACCTCCGCCTCCCAGGTTCAGG - Intergenic
1017436698 6:154422238-154422260 CGCCTCAGCCTCCCAAGTGCTGG + Intronic
1017696602 6:157021747-157021769 GGCCGCCGCCTCCCGCCTCCAGG - Intronic
1017719952 6:157236832-157236854 CGCCGCCACGTGCCGAGGTCGGG - Intergenic
1017946166 6:159098070-159098092 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1017960324 6:159216041-159216063 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1018414155 6:163586843-163586865 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1019111176 6:169715483-169715505 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1019400425 7:849201-849223 CGCCTCAGCCTCCCAAGTGCTGG + Intronic
1019914883 7:4126470-4126492 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
1019921385 7:4165569-4165591 AACCTCTGCCTCCCGAGTTCAGG + Intronic
1019991028 7:4691414-4691436 AGCCTCCGCCTCCTGGGTTCAGG + Intronic
1020653367 7:10901692-10901714 CGCCTCGGCCTCCCAATTTCTGG - Intergenic
1020813758 7:12878447-12878469 TGCCTCAGCCTCCCGAGTACTGG - Intergenic
1021412055 7:20339944-20339966 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1021601663 7:22370245-22370267 AACCTCCGCCTCCCAAGTTCAGG - Intergenic
1021670641 7:23031977-23031999 CGCCTCGGCCTCCCAAGTACTGG + Intergenic
1021711541 7:23421089-23421111 AGCCTCTGCCTCCCGGGTTCAGG + Intronic
1021733803 7:23623053-23623075 AGCCTCTGCCTCCCGGGTTCAGG + Intronic
1022354065 7:29595093-29595115 AACCTCCGCCTCCTGAGTTCAGG - Intergenic
1022459624 7:30593257-30593279 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1022773681 7:33502022-33502044 TGCCTCAGCCTCCCGAGTACTGG + Intronic
1022915357 7:34944279-34944301 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1022923675 7:35039256-35039278 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1022932722 7:35137643-35137665 CGCCTCTGCCTCCCAAGTGCTGG - Intergenic
1022991788 7:35715531-35715553 AGCCTCCGCCTCCTGGGTTCAGG + Intergenic
1023139268 7:37084836-37084858 AACCTCTGCCTCCCGAGTTCAGG + Intronic
1023436385 7:40144415-40144437 CGCCGCCCCCTCCAGAGTCATGG - Intronic
1023607389 7:41942864-41942886 CGCACCCGCCTCCCCAGCTCAGG + Intergenic
1023799458 7:43821375-43821397 CGCTGCCCCCTCCAGAGTTGTGG + Intergenic
1023950648 7:44841589-44841611 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1023972703 7:45003155-45003177 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1023980114 7:45064591-45064613 CGCCGCCGTCTCCTATGTTCGGG + Exonic
1024582935 7:50814921-50814943 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1025013536 7:55419481-55419503 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1025073168 7:55918910-55918932 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1025206282 7:56995196-56995218 CGCCTCAGCCTCCCAAGTGCTGG - Intergenic
1025665654 7:63581731-63581753 CGCCTCAGCCTCCCAAGTGCTGG + Intergenic
1025742375 7:64207903-64207925 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1025953596 7:66165493-66165515 TGCCTCAGCCTCCCGAGTACAGG - Intergenic
1026008324 7:66617066-66617088 TGCCTCAGCCTCCCGAGTACAGG + Intergenic
1026072013 7:67130297-67130319 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1026189683 7:68113315-68113337 AGCCTCCTCCTCCCGGGTTCAGG - Intergenic
1026322087 7:69277035-69277057 TGCCGCAGCCTCCCGAGTCATGG + Intergenic
1026337580 7:69407913-69407935 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1026348363 7:69494516-69494538 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1026500532 7:70939713-70939735 TGCCTCAGCCTCCCGAGTGCTGG + Intergenic
1026509031 7:71012462-71012484 AGCCTCCGCCTCCCATGTTCAGG + Intergenic
1026704893 7:72681957-72681979 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1026744607 7:73001264-73001286 CACCTCCGCCTCCCGGGTTCAGG - Intergenic
1026933632 7:74239109-74239131 CACCTCCGCCTCCCAAGTGCTGG + Intronic
1026934623 7:74246315-74246337 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1026942972 7:74298612-74298634 GGCCTCCGCCTCCTGGGTTCAGG + Intronic
1027030715 7:74885929-74885951 CACCTCCGCCTCCCGGGTTCAGG - Intergenic
1027099130 7:75363828-75363850 CACCTCCGCCTCCCGGGTTCAGG + Intergenic
1027183655 7:75956805-75956827 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1027184785 7:75964387-75964409 CACCTCCGCCTCCCGGCTTCAGG + Intronic
1027374261 7:77535571-77535593 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1027380477 7:77604000-77604022 TGCCTCAGCCTCCCGAGTACTGG + Intronic
1027664080 7:81022433-81022455 AGCCTCTGCCTCCCGGGTTCAGG - Intergenic
1027925885 7:84463328-84463350 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1028208564 7:88045097-88045119 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1028333935 7:89628425-89628447 CGCCGCCCCCTCCAGAGTCGTGG + Intergenic
1028419174 7:90612688-90612710 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1028707866 7:93871039-93871061 GAGCTCCGCCTCCCGAGTTCTGG - Intronic
1028824931 7:95260595-95260617 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1029157982 7:98530863-98530885 TGCCCCAGCCTCCCGAGTACTGG + Intergenic
1029366395 7:100119267-100119289 CGCCCCCGCCACCCGAGCGCGGG + Intronic
1029400230 7:100340608-100340630 CACCTCCGCCTCCCGGGTTCAGG + Intronic
1029544452 7:101202898-101202920 CGCCTGCGCCTCCCAAGTGCTGG + Intergenic
1029690967 7:102181187-102181209 CGCCTCCGCCTCCCAAATGCTGG + Intronic
1029828642 7:103230410-103230432 CGCCTCTGCCTCCCAAGTGCTGG - Intergenic
1029896497 7:103989714-103989736 CGCCGCCGCCACACGTGTCCCGG + Intergenic
1030015860 7:105220278-105220300 CGCCTCCGCCTCCCGGTTACAGG - Intronic
1030307227 7:108031207-108031229 TGCCTCAGCCTCCCGAGTACTGG - Intronic
1030326813 7:108228238-108228260 AGCCTCTGCCTCCCGGGTTCAGG - Intronic
1030447911 7:109670627-109670649 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1030687716 7:112504076-112504098 CGCCTCGGCCTCCCAAGTGCTGG - Intergenic
1030791322 7:113732596-113732618 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1031132968 7:117854864-117854886 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1031335400 7:120524151-120524173 AGCCTCCACCTCCCGGGTTCCGG - Intronic
1032126819 7:129201291-129201313 CGCCTCGGCCTCCCAAGTTCTGG + Intronic
1032149901 7:129419470-129419492 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1032218193 7:129973614-129973636 CGCCTCGGCCTCCCAAGTGCTGG + Intergenic
1032233952 7:130103310-130103332 CGCCTCAGCCTCCCGAGTAGCGG - Intronic
1032295111 7:130630029-130630051 CGCCTCAGCCTCCCAAGTACTGG + Intronic
1032386804 7:131530808-131530830 CGCCTTGGCCTCCCGAGTGCTGG - Intronic
1032833528 7:135652357-135652379 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1033054415 7:138036646-138036668 AACCTCCGCCTCCTGAGTTCAGG + Intronic
1033087748 7:138357797-138357819 CGCCTCGGCCTCCCAAGTTGTGG + Intergenic
1033099859 7:138460662-138460684 CGCCGCCGCGCTCCGAGTCCGGG - Exonic
1033200705 7:139367056-139367078 AACCTCCGCCTCTCGAGTTCAGG + Intronic
1033343322 7:140508577-140508599 AACCTCTGCCTCCCGAGTTCAGG - Intergenic
1033460919 7:141546881-141546903 AGCCTCCGCCTCCCAGGTTCTGG + Intergenic
1033542986 7:142374177-142374199 CGCCTCAGCCTCCCAAGTGCTGG + Intergenic
1033589311 7:142796921-142796943 GGGCGCCCCCTCCCCAGTTCCGG - Intergenic
1033628055 7:143130298-143130320 AGCCTCCACCTCCCGGGTTCAGG - Intergenic
1034059189 7:148070466-148070488 TGCCTCGGCCTCCCGAGTGCTGG - Intronic
1034609076 7:152348515-152348537 AGCCTCCACCTCCCGGGTTCAGG - Intronic
1034611624 7:152375632-152375654 CGCCTCAGCCTCCCAAGTGCTGG + Intronic
1034650618 7:152687326-152687348 TGCCGCAGCCTCCCGAGTGTTGG - Intergenic
1034916045 7:155039882-155039904 CACCTCAGCCTCCCAAGTTCTGG + Intergenic
1035000959 7:155611763-155611785 TACCTCCGCCTCCCGGGTTCAGG + Intronic
1035152633 7:156887379-156887401 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1035169567 7:157010041-157010063 CGCCGCCGCCGCCCGCGCCCAGG + Exonic
1035719527 8:1781274-1781296 AACCTCCGCCTCCCGGGTTCAGG - Exonic
1035740141 8:1921477-1921499 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
1036161617 8:6394189-6394211 CGCCTCGGCCTCCCAAGTGCTGG - Intergenic
1036417267 8:8562357-8562379 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1037143978 8:15550918-15550940 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1037536037 8:19825442-19825464 AGCCTCTGCCTCCCGGGTTCAGG - Intronic
1037651481 8:20842800-20842822 AGCCTCCGTCTCCCGGGTTCAGG - Intergenic
1038204332 8:25450738-25450760 CGCCTCAGCCTCCCAAGTGCTGG + Intronic
1038540141 8:28385235-28385257 CGCCGCCGCCTCCCGGTTTTGGG - Intronic
1038540310 8:28385742-28385764 CGGAGCCCCCTCCCGACTTCGGG - Intronic
1038762291 8:30395381-30395403 CGCCTCGACCTCCCGAGCTCAGG - Intronic
1038799678 8:30738409-30738431 CGCCTCGGCCTCCCGAGTGCTGG - Intronic
1039027821 8:33277121-33277143 TGCCTCAGCCTCCCGAGTGCTGG - Intergenic
1039517013 8:38142608-38142630 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1039700638 8:39958313-39958335 CGCCTCTGCCTCCCAGGTTCAGG + Intronic
1039707929 8:40026277-40026299 CGCCTCGGCCTCCCAAGTGCTGG - Intergenic
1039935508 8:42040651-42040673 AGCCTCCGCCTCCTGGGTTCAGG - Intronic
1039974155 8:42346001-42346023 AGCCTCCGCCTCCAGGGTTCAGG + Intronic
1040505924 8:48047637-48047659 AGTTGCCACCTCCCGAGTTCAGG + Intronic
1040816989 8:51519290-51519312 TGCCTCAGCCTCCCAAGTTCTGG - Intronic
1041107560 8:54457993-54458015 CGAAGCCGCCGCCCGTGTTCTGG - Exonic
1041230619 8:55747278-55747300 GGCCTCCACCTCCCGGGTTCAGG - Intronic
1041267834 8:56082438-56082460 AGCCTCCGCCTCCCCGGTTCAGG + Intergenic
1041441672 8:57903723-57903745 AACCTCCGCCTCCCAAGTTCAGG - Intergenic
1041515424 8:58694415-58694437 CGCCACCCCCTCCAGAGTCCTGG + Intergenic
1041703531 8:60819033-60819055 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1042148251 8:65754881-65754903 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1042176340 8:66040306-66040328 AACCTCCGCCTCCTGAGTTCAGG - Intronic
1042233317 8:66581560-66581582 CACCTCAGCCTCTCGAGTTCTGG - Intronic
1042256385 8:66808593-66808615 AGCCTCCACCTCCTGAGTTCAGG + Intronic
1042283151 8:67077415-67077437 CGCCTCCACCTCCCAGGTTCAGG + Intronic
1042290009 8:67160381-67160403 AACCTCCGCCTCCCAAGTTCAGG - Intronic
1042329993 8:67568830-67568852 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1042937628 8:74076403-74076425 GACCTCCGCCTCCCGGGTTCAGG + Intergenic
1043418145 8:80072224-80072246 AACCTCTGCCTCCCGAGTTCAGG - Intronic
1043463894 8:80486696-80486718 CGCCCCCGCCCCCGGCGTTCCGG - Exonic
1043726244 8:83614690-83614712 AGCCTCCACCTCCCAAGTTCAGG + Intergenic
1043841281 8:85107288-85107310 CGCCGCCGCCTCCATAGCACTGG - Exonic
1043927239 8:86051145-86051167 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1044567962 8:93685526-93685548 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1044913657 8:97089159-97089181 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1044973888 8:97644763-97644785 CGCCGCCTCCTCCCGCTTGCGGG - Exonic
1045149700 8:99390349-99390371 CGCCTCAGCCTCCCAAGTGCTGG + Intronic
1045305028 8:100951334-100951356 CGCCACCGCCTCCCGGGGTGGGG + Intronic
1046910285 8:119618781-119618803 CGCCTCAGCCTCCCAAGTGCTGG + Intronic
1046923054 8:119754599-119754621 AACCTCCGCCTCCCAAGTTCAGG - Intronic
1047248704 8:123165927-123165949 AACCTCTGCCTCCCGAGTTCAGG - Intergenic
1047268063 8:123326988-123327010 TGCCTCCACCTCCCGGGTTCAGG + Intronic
1047277222 8:123415674-123415696 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1047462545 8:125081317-125081339 AACCTTCGCCTCCCGAGTTCAGG + Intronic
1047756703 8:127924416-127924438 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1048236790 8:132698830-132698852 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
1048552745 8:135448791-135448813 TGCCCCAGCCTCCCCAGTTCTGG - Intergenic
1048714538 8:137253392-137253414 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1049007984 8:139868272-139868294 AGCCTCCGCCTCCTGGGTTCAGG - Intronic
1049152616 8:141045064-141045086 AACCTCCGCCTCCCGAGTTCAGG - Intergenic
1049754262 8:144302050-144302072 CGCCTCAGCCTCCCGAGTAGCGG - Intronic
1049830362 8:144697599-144697621 AACCTCCACCTCCCGAGTTCAGG + Intergenic
1049868021 8:144951370-144951392 CGCCTCGGCCTCCCAAGTGCTGG - Intergenic
1050007898 9:1152963-1152985 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1050427614 9:5527908-5527930 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1050870592 9:10564111-10564133 CACCTCAGCCTCCCGAGTGCTGG + Intronic
1051171572 9:14322712-14322734 CGCTCCCGCCTCCCGGGTCCCGG - Intronic
1051386371 9:16513551-16513573 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1051410104 9:16780488-16780510 AGCCTCCGCCTCCTGGGTTCAGG - Intronic
1051637641 9:19195402-19195424 CACCTCCGCCTCCTGGGTTCAGG - Intergenic
1052175183 9:25452649-25452671 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1052208917 9:25878163-25878185 CGCCTCAGCCTCCCGAGTAGCGG + Intergenic
1052235918 9:26213482-26213504 AGCTTCCGCCTCCCGGGTTCAGG - Intergenic
1053031227 9:34780408-34780430 CGCCTCAGCCTCCCGAGTACAGG + Intergenic
1053070207 9:35096573-35096595 CGCCGCCGCCGCCGCACTTCCGG - Intronic
1053477084 9:38390275-38390297 CGCCTCCGCCTCCCCAATTCAGG - Intergenic
1053507765 9:38658911-38658933 CGCCTCAGCCTCCCAAGTGCTGG + Intergenic
1053625860 9:39869871-39869893 TGCCTCAGCCTCCCGAGTACAGG + Intergenic
1054218028 9:62380830-62380852 TGCCTCAGCCTCCCGAGTACAGG - Intergenic
1054734167 9:68733719-68733741 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1054776697 9:69129931-69129953 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1055023424 9:71694202-71694224 AGTCTCCGCCTCCCGGGTTCAGG + Intronic
1055456013 9:76472199-76472221 ATCCTCCGCCTCCCGGGTTCGGG - Intronic
1055527107 9:77146149-77146171 AACCACCGCCTCCCGGGTTCAGG + Intergenic
1055684928 9:78761990-78762012 CGCCTCAGCCTCCCGAGTAGTGG - Intergenic
1055944315 9:81679064-81679086 AGCCTCCGCCTCCTGGGTTCAGG - Intronic
1056168457 9:83960169-83960191 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1056452505 9:86729636-86729658 TGCCTCAGCCTCCCGAGTGCTGG - Intergenic
1057352187 9:94308220-94308242 AGCCTCCGCCTCCTGGGTTCAGG - Intergenic
1057366027 9:94422024-94422046 TGCCTCAGCCTCCCGAGTCCCGG + Intronic
1057388957 9:94627271-94627293 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1057563270 9:96145668-96145690 TGCCTCAGCCTCCCGAGTGCTGG + Intergenic
1057596119 9:96417654-96417676 CGCCGCCGCCTCGGGAGGTGAGG - Exonic
1057598204 9:96434455-96434477 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1057655455 9:96947870-96947892 AGCCTCCGCCTCCTGGGTTCAGG + Intronic
1057657307 9:96966041-96966063 TGCCTCAGCCTCCCGAGTCCCGG - Intronic
1057771048 9:97968346-97968368 AGCCTCCGCCTCCTGGGTTCAGG - Intergenic
1057811784 9:98262953-98262975 AGCCTCCGCCTCCCGGGTTCAGG - Intergenic
1058251650 9:102705393-102705415 AGCCACCGCCTCCCGGGTTCAGG - Intergenic
1058316287 9:103570590-103570612 CGCCTCAGCCTCCCAAGTGCTGG + Intergenic
1058665993 9:107316257-107316279 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1058695081 9:107552049-107552071 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1058701658 9:107605812-107605834 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1058706537 9:107642195-107642217 CGCCTCGGCCTCCCAAGTGCTGG + Intergenic
1058709473 9:107666924-107666946 AGCCTCCGCCTCCCAGGTTCAGG - Intergenic
1059148949 9:111929898-111929920 AGCCTCTGCCTCCCGGGTTCAGG + Intronic
1059878988 9:118668705-118668727 AACCTCCGCCTCCAGAGTTCAGG + Intergenic
1060120100 9:120980843-120980865 CGCCTCGGCCTCCCAAGTGCTGG + Intronic
1060135701 9:121151470-121151492 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1060393897 9:123302261-123302283 CGCCTCCGCCTCCAAAGTGCTGG + Intergenic
1060599582 9:124869127-124869149 CGCCGCCGCCCGCCCACTTCCGG - Exonic
1060677529 9:125528763-125528785 AACCTCCGCCTCCCGAGTTCAGG - Intronic
1061029423 9:128070834-128070856 TGCCTCAGCCTCCCGAGTACTGG - Intronic
1061051766 9:128200753-128200775 AACCTCCGCCTCCCAAGTTCAGG - Intronic
1061384645 9:130281806-130281828 AGCCTCCGCCTCCTGGGTTCAGG - Intergenic
1061409561 9:130412051-130412073 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1061452311 9:130674959-130674981 AACCTCCGCCTCCCAAGTTCAGG + Intronic
1061470552 9:130821951-130821973 CGCCTCAGCCTCCCAAGTACTGG + Intronic
1061488278 9:130931259-130931281 CGCCTCGGCCTCCCAAGTGCTGG - Intronic
1061684016 9:132259831-132259853 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1062014065 9:134282512-134282534 CGTCGCCACCTCCTGAGCTCTGG + Intergenic
1062330523 9:136041336-136041358 AGCCTCCGCCTCCTGGGTTCAGG - Intronic
1062410240 9:136420247-136420269 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1062666553 9:137676445-137676467 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1203731888 Un_GL000216v2:98846-98868 CAGCGACGCCTCCCGAGTCCCGG + Intergenic
1203654120 Un_KI270752v1:7333-7355 TGCCTCTGCCTCCCGAGTGCTGG + Intergenic
1203655527 Un_KI270752v1:20652-20674 TGCCTCTGCCTCCCGAGTGCTGG + Intergenic
1185487779 X:496471-496493 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1185571968 X:1141440-1141462 TGCCTCAGCCTCCCGAGTACAGG - Intergenic
1185632003 X:1522032-1522054 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1185646595 X:1620251-1620273 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1185755783 X:2652014-2652036 CACCTCCGCCTCCCGGGTTCAGG + Intergenic
1185777709 X:2818866-2818888 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1185944422 X:4358368-4358390 AGCCTCAGCCTCCTGAGTTCAGG - Intergenic
1186191432 X:7070657-7070679 CACCTCTGCCTCCCGGGTTCAGG + Intronic
1187009965 X:15268730-15268752 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1187055958 X:15741590-15741612 TGCCTCAGCCTCCCGAGTACAGG + Intronic
1187079140 X:15967604-15967626 CACCTCCGCCTCCCGGGTTCAGG - Intergenic
1187174022 X:16879475-16879497 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1187806670 X:23128524-23128546 CGCCTCAGCCTCCCAAGTGCTGG + Intergenic
1187884537 X:23876715-23876737 AACCTCCGCCTCCCGGGTTCAGG - Intronic
1188294530 X:28431397-28431419 CGCCTCGGCCTCCCAAGTGCTGG + Intergenic
1188786162 X:34349424-34349446 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1188808216 X:34618386-34618408 AACCTCCGCCTCCCGGGTTCCGG + Intergenic
1189014873 X:37086628-37086650 CGCCTCGACCTCCCGAGCTCAGG - Intergenic
1189034521 X:37482235-37482257 TGCCGCCCCCTCCTGAGTTGTGG + Intronic
1189323038 X:40097646-40097668 TGCCGCCGCCGCCCGCGCTCGGG + Intronic
1189476293 X:41358838-41358860 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1190020497 X:46869689-46869711 AACCCCCGCCTCCCGGGTTCAGG + Intronic
1190070014 X:47271907-47271929 AGCCTCCGCCTCCTGGGTTCAGG - Intergenic
1190389509 X:49918246-49918268 CACCTCCGCCTCCTGGGTTCAGG + Intergenic
1190574101 X:51815634-51815656 TGCCTCAGCCTCCGGAGTTCTGG + Intronic
1190815263 X:53923943-53923965 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1190963293 X:55273492-55273514 GGCCTCCACCTCCCGAGTTCAGG + Intronic
1191639192 X:63412278-63412300 CGCCACCCCCTCCAGAGTTGTGG + Intergenic
1191831663 X:65421832-65421854 TGCCTCAGCCTCCCGAGTGCTGG - Intronic
1192098803 X:68241837-68241859 AACCTCCGCCTCCCAAGTTCAGG - Intronic
1192124531 X:68489483-68489505 GACCGCCGCCTCCCAGGTTCAGG - Intergenic
1192224830 X:69221080-69221102 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1192458002 X:71293711-71293733 AACCTCCGCCTCCCGGGTTCAGG + Intronic
1192488496 X:71552138-71552160 CTCCTCCTCCTCCCGGGTTCAGG - Intronic
1192493269 X:71595176-71595198 AGCCTCCGCCTCCTGAGTTCTGG + Intronic
1193309763 X:79992113-79992135 CGCCTCAGCCTCCCAAGTGCTGG - Intergenic
1193335291 X:80280876-80280898 CGCCTCGGCCTCCCAAGTGCTGG + Intergenic
1193539285 X:82752043-82752065 CGCCCCGGCCTCCCAAGTGCTGG - Intergenic
1193810954 X:86050376-86050398 TGCCTCAGCCTCCCGAGTTGCGG + Intergenic
1194414722 X:93597090-93597112 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1194825262 X:98554293-98554315 TGCCTCAGCCTCCCAAGTTCTGG + Intergenic
1195069744 X:101267435-101267457 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1196707431 X:118727955-118727977 CTCCGCCGCACCCGGAGTTCGGG - Intronic
1196768028 X:119267400-119267422 AGCCTCTGCCTCCCGGGTTCAGG + Intergenic
1197229386 X:123987328-123987350 AACCTCCGCCTCCCAAGTTCAGG + Intronic
1197776327 X:130120875-130120897 CGCCGCCGCGTTCCGCGTGCAGG - Intergenic
1198106484 X:133466899-133466921 AACCTCCGCCTCCCTAGTTCAGG + Intergenic
1198195671 X:134358633-134358655 AACCTCCGCCTCCCGCGTTCAGG - Intergenic
1198252132 X:134889987-134890009 AACCTCCGCCTCCCCAGTTCAGG - Intronic
1198341543 X:135719434-135719456 TGCCGCAGCCTCCCGAGTAGCGG + Intronic
1198346455 X:135763927-135763949 TGCCGCAGCCTCCCGAGTAGCGG - Intronic
1198348361 X:135781212-135781234 TGCCGCAGCCTCCCGAGTAGCGG - Intergenic
1198350265 X:135798474-135798496 TGCCGCAGCCTCCCGAGTAGCGG - Intronic
1198352173 X:135815748-135815770 TGCCGCAGCCTCCCGAGTAGCGG - Intronic
1198354081 X:135833016-135833038 TGCCGCAGCCTCCCGAGTAGCGG - Intronic
1198355991 X:135850265-135850287 TGCCGCAGCCTCCCGAGTAGCGG - Intronic
1198357904 X:135867545-135867567 TGCCGCAGCCTCCCGAGTAGCGG - Intergenic
1198359818 X:135884827-135884849 TGCCGCAGCCTCCCGAGTAGCGG - Intronic
1198742428 X:139855528-139855550 CGCCACCCCCTCCAGAGTTGTGG + Intronic
1199382752 X:147190034-147190056 AACCTCCGCCTCCCGGGTTCAGG + Intergenic
1199816003 X:151397340-151397362 CACTGCAGCCTCCTGAGTTCAGG + Exonic
1200310260 X:155071085-155071107 GGCAGGCGCCTCCCGAGTACCGG - Exonic
1201057295 Y:10008039-10008061 CGCCTCAGCCTCCCAAGTTAAGG + Intergenic
1201224438 Y:11804180-11804202 AACCTCCGCCTCCCGGGTTCAGG - Intergenic
1201318634 Y:12673054-12673076 TGCCTCAGCCTCCCGAGTACAGG + Intergenic
1201381204 Y:13381440-13381462 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
1201647730 Y:16253986-16254008 TGCCTCAGCCTCCCGAGTACTGG - Intergenic
1201655081 Y:16331311-16331333 TGCCTCAGCCTCCCGAGTACTGG + Intergenic
1201726584 Y:17158711-17158733 TGCCTCAGCCTCCCGAGTTCTGG - Intergenic
1202103309 Y:21333681-21333703 CGCCTCAGCCTCCCAAGTTAAGG - Intergenic