ID: 1176952669

View in Genome Browser
Species Human (GRCh38)
Location 21:15064962-15064984
Sequence GCCGCCGCCTCCCGAGTTCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4807
Summary {0: 1, 1: 1, 2: 1, 3: 124, 4: 4680}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176952662_1176952669 -9 Left 1176952662 21:15064948-15064970 CCGCCGCCTCCTCCGCCGCCGCC 0: 8
1: 64
2: 1376
3: 2477
4: 8374
Right 1176952669 21:15064962-15064984 GCCGCCGCCTCCCGAGTTCGGGG 0: 1
1: 1
2: 1
3: 124
4: 4680
1176952659_1176952669 3 Left 1176952659 21:15064936-15064958 CCCTGCGCCTCGCCGCCGCCTCC 0: 1
1: 0
2: 5
3: 62
4: 500
Right 1176952669 21:15064962-15064984 GCCGCCGCCTCCCGAGTTCGGGG 0: 1
1: 1
2: 1
3: 124
4: 4680
1176952658_1176952669 12 Left 1176952658 21:15064927-15064949 CCGGGTCGTCCCTGCGCCTCGCC 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1176952669 21:15064962-15064984 GCCGCCGCCTCCCGAGTTCGGGG 0: 1
1: 1
2: 1
3: 124
4: 4680
1176952660_1176952669 2 Left 1176952660 21:15064937-15064959 CCTGCGCCTCGCCGCCGCCTCCT 0: 1
1: 1
2: 5
3: 82
4: 610
Right 1176952669 21:15064962-15064984 GCCGCCGCCTCCCGAGTTCGGGG 0: 1
1: 1
2: 1
3: 124
4: 4680
1176952661_1176952669 -4 Left 1176952661 21:15064943-15064965 CCTCGCCGCCGCCTCCTCCGCCG 0: 1
1: 6
2: 141
3: 465
4: 1595
Right 1176952669 21:15064962-15064984 GCCGCCGCCTCCCGAGTTCGGGG 0: 1
1: 1
2: 1
3: 124
4: 4680

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176952669 Original CRISPR GCCGCCGCCTCCCGAGTTCG GGG Exonic
Too many off-targets to display for this crispr