ID: 1176957605

View in Genome Browser
Species Human (GRCh38)
Location 21:15124190-15124212
Sequence CTGGGTAAACAGAGGTAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176957601_1176957605 3 Left 1176957601 21:15124164-15124186 CCTCAGATGCATGAACGGAGGGT No data
Right 1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG No data
1176957597_1176957605 21 Left 1176957597 21:15124146-15124168 CCATTTGTGTTCATGCATCCTCA No data
Right 1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176957605 Original CRISPR CTGGGTAAACAGAGGTAAGA CGG Intergenic
No off target data available for this crispr