ID: 1176958184

View in Genome Browser
Species Human (GRCh38)
Location 21:15129999-15130021
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176958177_1176958184 12 Left 1176958177 21:15129964-15129986 CCAATAGAGCTGAGGTTGAGAAG No data
Right 1176958184 21:15129999-15130021 TAGATCATGCAGGATCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176958184 Original CRISPR TAGATCATGCAGGATCTTGA AGG Intergenic
No off target data available for this crispr