ID: 1176960062

View in Genome Browser
Species Human (GRCh38)
Location 21:15149357-15149379
Sequence GTTTTTTGACTTTTATTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176960062_1176960065 30 Left 1176960062 21:15149357-15149379 CCAAAAAATAAAAGTCAAAAAAC No data
Right 1176960065 21:15149410-15149432 CTACGTAGCTAATGAGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176960062 Original CRISPR GTTTTTTGACTTTTATTTTT TGG (reversed) Intergenic
No off target data available for this crispr