ID: 1176960064

View in Genome Browser
Species Human (GRCh38)
Location 21:15149396-15149418
Sequence GCTACGTAGTCAGCTGATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176960064_1176960067 -2 Left 1176960064 21:15149396-15149418 CCACTATCAGCTGACTACGTAGC No data
Right 1176960067 21:15149417-15149439 GCTAATGAGCTCATGGCCATGGG No data
1176960064_1176960068 -1 Left 1176960064 21:15149396-15149418 CCACTATCAGCTGACTACGTAGC No data
Right 1176960068 21:15149418-15149440 CTAATGAGCTCATGGCCATGGGG No data
1176960064_1176960070 4 Left 1176960064 21:15149396-15149418 CCACTATCAGCTGACTACGTAGC No data
Right 1176960070 21:15149423-15149445 GAGCTCATGGCCATGGGGGTAGG No data
1176960064_1176960072 15 Left 1176960064 21:15149396-15149418 CCACTATCAGCTGACTACGTAGC No data
Right 1176960072 21:15149434-15149456 CATGGGGGTAGGAACTACTTTGG No data
1176960064_1176960066 -3 Left 1176960064 21:15149396-15149418 CCACTATCAGCTGACTACGTAGC No data
Right 1176960066 21:15149416-15149438 AGCTAATGAGCTCATGGCCATGG No data
1176960064_1176960069 0 Left 1176960064 21:15149396-15149418 CCACTATCAGCTGACTACGTAGC No data
Right 1176960069 21:15149419-15149441 TAATGAGCTCATGGCCATGGGGG No data
1176960064_1176960065 -9 Left 1176960064 21:15149396-15149418 CCACTATCAGCTGACTACGTAGC No data
Right 1176960065 21:15149410-15149432 CTACGTAGCTAATGAGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176960064 Original CRISPR GCTACGTAGTCAGCTGATAG TGG (reversed) Intergenic
No off target data available for this crispr