ID: 1176960066

View in Genome Browser
Species Human (GRCh38)
Location 21:15149416-15149438
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176960064_1176960066 -3 Left 1176960064 21:15149396-15149418 CCACTATCAGCTGACTACGTAGC No data
Right 1176960066 21:15149416-15149438 AGCTAATGAGCTCATGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176960066 Original CRISPR AGCTAATGAGCTCATGGCCA TGG Intergenic
No off target data available for this crispr