ID: 1176960069

View in Genome Browser
Species Human (GRCh38)
Location 21:15149419-15149441
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176960064_1176960069 0 Left 1176960064 21:15149396-15149418 CCACTATCAGCTGACTACGTAGC No data
Right 1176960069 21:15149419-15149441 TAATGAGCTCATGGCCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176960069 Original CRISPR TAATGAGCTCATGGCCATGG GGG Intergenic
No off target data available for this crispr