ID: 1176967962

View in Genome Browser
Species Human (GRCh38)
Location 21:15232708-15232730
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176967962_1176967966 2 Left 1176967962 21:15232708-15232730 CCCCTTCATCCATGGGGTAGGAC No data
Right 1176967966 21:15232733-15232755 AAGCTATGTCCTTAGATCAGAGG No data
1176967962_1176967968 16 Left 1176967962 21:15232708-15232730 CCCCTTCATCCATGGGGTAGGAC No data
Right 1176967968 21:15232747-15232769 GATCAGAGGCTCTTCCTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176967962 Original CRISPR GTCCTACCCCATGGATGAAG GGG (reversed) Intergenic