ID: 1176967964

View in Genome Browser
Species Human (GRCh38)
Location 21:15232710-15232732
Sequence CTGTCCTACCCCATGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176967964_1176967968 14 Left 1176967964 21:15232710-15232732 CCTTCATCCATGGGGTAGGACAG No data
Right 1176967968 21:15232747-15232769 GATCAGAGGCTCTTCCTATGTGG No data
1176967964_1176967966 0 Left 1176967964 21:15232710-15232732 CCTTCATCCATGGGGTAGGACAG No data
Right 1176967966 21:15232733-15232755 AAGCTATGTCCTTAGATCAGAGG No data
1176967964_1176967970 30 Left 1176967964 21:15232710-15232732 CCTTCATCCATGGGGTAGGACAG No data
Right 1176967970 21:15232763-15232785 TATGTGGCATTTCTGTGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176967964 Original CRISPR CTGTCCTACCCCATGGATGA AGG (reversed) Intergenic
No off target data available for this crispr