ID: 1176967965 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:15232717-15232739 |
| Sequence | ATAGCTTCTGTCCTACCCCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1176967965_1176967968 | 7 | Left | 1176967965 | 21:15232717-15232739 | CCATGGGGTAGGACAGAAGCTAT | No data | ||
| Right | 1176967968 | 21:15232747-15232769 | GATCAGAGGCTCTTCCTATGTGG | No data | ||||
| 1176967965_1176967970 | 23 | Left | 1176967965 | 21:15232717-15232739 | CCATGGGGTAGGACAGAAGCTAT | No data | ||
| Right | 1176967970 | 21:15232763-15232785 | TATGTGGCATTTCTGTGTATTGG | No data | ||||
| 1176967965_1176967966 | -7 | Left | 1176967965 | 21:15232717-15232739 | CCATGGGGTAGGACAGAAGCTAT | No data | ||
| Right | 1176967966 | 21:15232733-15232755 | AAGCTATGTCCTTAGATCAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1176967965 | Original CRISPR | ATAGCTTCTGTCCTACCCCA TGG (reversed) | Intergenic | ||