ID: 1176967966

View in Genome Browser
Species Human (GRCh38)
Location 21:15232733-15232755
Sequence AAGCTATGTCCTTAGATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176967962_1176967966 2 Left 1176967962 21:15232708-15232730 CCCCTTCATCCATGGGGTAGGAC No data
Right 1176967966 21:15232733-15232755 AAGCTATGTCCTTAGATCAGAGG No data
1176967963_1176967966 1 Left 1176967963 21:15232709-15232731 CCCTTCATCCATGGGGTAGGACA No data
Right 1176967966 21:15232733-15232755 AAGCTATGTCCTTAGATCAGAGG No data
1176967964_1176967966 0 Left 1176967964 21:15232710-15232732 CCTTCATCCATGGGGTAGGACAG No data
Right 1176967966 21:15232733-15232755 AAGCTATGTCCTTAGATCAGAGG No data
1176967960_1176967966 6 Left 1176967960 21:15232704-15232726 CCTACCCCTTCATCCATGGGGTA No data
Right 1176967966 21:15232733-15232755 AAGCTATGTCCTTAGATCAGAGG No data
1176967965_1176967966 -7 Left 1176967965 21:15232717-15232739 CCATGGGGTAGGACAGAAGCTAT No data
Right 1176967966 21:15232733-15232755 AAGCTATGTCCTTAGATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176967966 Original CRISPR AAGCTATGTCCTTAGATCAG AGG Intergenic
No off target data available for this crispr