ID: 1176967968

View in Genome Browser
Species Human (GRCh38)
Location 21:15232747-15232769
Sequence GATCAGAGGCTCTTCCTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176967963_1176967968 15 Left 1176967963 21:15232709-15232731 CCCTTCATCCATGGGGTAGGACA No data
Right 1176967968 21:15232747-15232769 GATCAGAGGCTCTTCCTATGTGG No data
1176967960_1176967968 20 Left 1176967960 21:15232704-15232726 CCTACCCCTTCATCCATGGGGTA No data
Right 1176967968 21:15232747-15232769 GATCAGAGGCTCTTCCTATGTGG No data
1176967965_1176967968 7 Left 1176967965 21:15232717-15232739 CCATGGGGTAGGACAGAAGCTAT No data
Right 1176967968 21:15232747-15232769 GATCAGAGGCTCTTCCTATGTGG No data
1176967962_1176967968 16 Left 1176967962 21:15232708-15232730 CCCCTTCATCCATGGGGTAGGAC No data
Right 1176967968 21:15232747-15232769 GATCAGAGGCTCTTCCTATGTGG No data
1176967964_1176967968 14 Left 1176967964 21:15232710-15232732 CCTTCATCCATGGGGTAGGACAG No data
Right 1176967968 21:15232747-15232769 GATCAGAGGCTCTTCCTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176967968 Original CRISPR GATCAGAGGCTCTTCCTATG TGG Intergenic
No off target data available for this crispr