ID: 1176968004

View in Genome Browser
Species Human (GRCh38)
Location 21:15233359-15233381
Sequence CCACTTTGACTACTATTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176968000_1176968004 19 Left 1176968000 21:15233317-15233339 CCATTTGTTCCTTTATTTATTTA No data
Right 1176968004 21:15233359-15233381 CCACTTTGACTACTATTGATTGG No data
1176968001_1176968004 10 Left 1176968001 21:15233326-15233348 CCTTTATTTATTTATTTTGTTGC No data
Right 1176968004 21:15233359-15233381 CCACTTTGACTACTATTGATTGG No data
1176967999_1176968004 30 Left 1176967999 21:15233306-15233328 CCTGAATGTCTCCATTTGTTCCT No data
Right 1176968004 21:15233359-15233381 CCACTTTGACTACTATTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176968004 Original CRISPR CCACTTTGACTACTATTGAT TGG Intergenic
No off target data available for this crispr