ID: 1176970283

View in Genome Browser
Species Human (GRCh38)
Location 21:15257072-15257094
Sequence TTAAAAAAAAAGACCACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176970281_1176970283 19 Left 1176970281 21:15257030-15257052 CCCATACAATATTTAGAGAGACA No data
Right 1176970283 21:15257072-15257094 TTAAAAAAAAAGACCACTGAAGG No data
1176970282_1176970283 18 Left 1176970282 21:15257031-15257053 CCATACAATATTTAGAGAGACAA No data
Right 1176970283 21:15257072-15257094 TTAAAAAAAAAGACCACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176970283 Original CRISPR TTAAAAAAAAAGACCACTGA AGG Intergenic
No off target data available for this crispr