ID: 1176970968

View in Genome Browser
Species Human (GRCh38)
Location 21:15265273-15265295
Sequence TCTCCTGGGGATTTGGCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176970968_1176970972 -10 Left 1176970968 21:15265273-15265295 CCCAATGCCAAATCCCCAGGAGA No data
Right 1176970972 21:15265286-15265308 CCCCAGGAGAGTCAATCCGATGG No data
1176970968_1176970977 -2 Left 1176970968 21:15265273-15265295 CCCAATGCCAAATCCCCAGGAGA No data
Right 1176970977 21:15265294-15265316 GAGTCAATCCGATGGGCCAAGGG No data
1176970968_1176970974 -9 Left 1176970968 21:15265273-15265295 CCCAATGCCAAATCCCCAGGAGA No data
Right 1176970974 21:15265287-15265309 CCCAGGAGAGTCAATCCGATGGG No data
1176970968_1176970976 -3 Left 1176970968 21:15265273-15265295 CCCAATGCCAAATCCCCAGGAGA No data
Right 1176970976 21:15265293-15265315 AGAGTCAATCCGATGGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176970968 Original CRISPR TCTCCTGGGGATTTGGCATT GGG (reversed) Intergenic
No off target data available for this crispr