ID: 1176972453

View in Genome Browser
Species Human (GRCh38)
Location 21:15282260-15282282
Sequence CAGAATAATTTGAAGGAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176972453_1176972457 14 Left 1176972453 21:15282260-15282282 CCTAATTCCTTCAAATTATTCTG No data
Right 1176972457 21:15282297-15282319 CTGAGTCTTTTATAACTTTTAGG No data
1176972453_1176972459 16 Left 1176972453 21:15282260-15282282 CCTAATTCCTTCAAATTATTCTG No data
Right 1176972459 21:15282299-15282321 GAGTCTTTTATAACTTTTAGGGG No data
1176972453_1176972458 15 Left 1176972453 21:15282260-15282282 CCTAATTCCTTCAAATTATTCTG No data
Right 1176972458 21:15282298-15282320 TGAGTCTTTTATAACTTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176972453 Original CRISPR CAGAATAATTTGAAGGAATT AGG (reversed) Intergenic
No off target data available for this crispr