ID: 1176974025

View in Genome Browser
Species Human (GRCh38)
Location 21:15298203-15298225
Sequence GGAGAGACAAAGTCTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176974018_1176974025 26 Left 1176974018 21:15298154-15298176 CCTAATTTAACATTCTGAAGCTA No data
Right 1176974025 21:15298203-15298225 GGAGAGACAAAGTCTCAGCTGGG No data
1176974020_1176974025 -9 Left 1176974020 21:15298189-15298211 CCTCCCCTTTCACAGGAGAGACA No data
Right 1176974025 21:15298203-15298225 GGAGAGACAAAGTCTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176974025 Original CRISPR GGAGAGACAAAGTCTCAGCT GGG Intergenic
No off target data available for this crispr