ID: 1176975116 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:15312245-15312267 |
Sequence | CAGGAGAGAGAGAGCGTGGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1176975116_1176975119 | -7 | Left | 1176975116 | 21:15312245-15312267 | CCCTCCACGCTCTCTCTCTCCTG | No data | ||
Right | 1176975119 | 21:15312261-15312283 | TCTCCTGCTGCCTTGTAAAGAGG | No data | ||||
1176975116_1176975120 | -6 | Left | 1176975116 | 21:15312245-15312267 | CCCTCCACGCTCTCTCTCTCCTG | No data | ||
Right | 1176975120 | 21:15312262-15312284 | CTCCTGCTGCCTTGTAAAGAGGG | 0: 17 1: 267 2: 864 3: 1458 4: 2288 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1176975116 | Original CRISPR | CAGGAGAGAGAGAGCGTGGA GGG (reversed) | Intergenic | ||
No off target data available for this crispr |