ID: 1176975116

View in Genome Browser
Species Human (GRCh38)
Location 21:15312245-15312267
Sequence CAGGAGAGAGAGAGCGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176975116_1176975119 -7 Left 1176975116 21:15312245-15312267 CCCTCCACGCTCTCTCTCTCCTG No data
Right 1176975119 21:15312261-15312283 TCTCCTGCTGCCTTGTAAAGAGG No data
1176975116_1176975120 -6 Left 1176975116 21:15312245-15312267 CCCTCCACGCTCTCTCTCTCCTG No data
Right 1176975120 21:15312262-15312284 CTCCTGCTGCCTTGTAAAGAGGG 0: 17
1: 267
2: 864
3: 1458
4: 2288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176975116 Original CRISPR CAGGAGAGAGAGAGCGTGGA GGG (reversed) Intergenic
No off target data available for this crispr