ID: 1176975119

View in Genome Browser
Species Human (GRCh38)
Location 21:15312261-15312283
Sequence TCTCCTGCTGCCTTGTAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176975115_1176975119 -6 Left 1176975115 21:15312244-15312266 CCCCTCCACGCTCTCTCTCTCCT No data
Right 1176975119 21:15312261-15312283 TCTCCTGCTGCCTTGTAAAGAGG No data
1176975117_1176975119 -8 Left 1176975117 21:15312246-15312268 CCTCCACGCTCTCTCTCTCCTGC No data
Right 1176975119 21:15312261-15312283 TCTCCTGCTGCCTTGTAAAGAGG No data
1176975116_1176975119 -7 Left 1176975116 21:15312245-15312267 CCCTCCACGCTCTCTCTCTCCTG No data
Right 1176975119 21:15312261-15312283 TCTCCTGCTGCCTTGTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176975119 Original CRISPR TCTCCTGCTGCCTTGTAAAG AGG Intergenic
No off target data available for this crispr