ID: 1176975120

View in Genome Browser
Species Human (GRCh38)
Location 21:15312262-15312284
Sequence CTCCTGCTGCCTTGTAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4894
Summary {0: 17, 1: 267, 2: 864, 3: 1458, 4: 2288}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176975118_1176975120 -10 Left 1176975118 21:15312249-15312271 CCACGCTCTCTCTCTCCTGCTGC No data
Right 1176975120 21:15312262-15312284 CTCCTGCTGCCTTGTAAAGAGGG 0: 17
1: 267
2: 864
3: 1458
4: 2288
1176975116_1176975120 -6 Left 1176975116 21:15312245-15312267 CCCTCCACGCTCTCTCTCTCCTG No data
Right 1176975120 21:15312262-15312284 CTCCTGCTGCCTTGTAAAGAGGG 0: 17
1: 267
2: 864
3: 1458
4: 2288
1176975115_1176975120 -5 Left 1176975115 21:15312244-15312266 CCCCTCCACGCTCTCTCTCTCCT No data
Right 1176975120 21:15312262-15312284 CTCCTGCTGCCTTGTAAAGAGGG 0: 17
1: 267
2: 864
3: 1458
4: 2288
1176975117_1176975120 -7 Left 1176975117 21:15312246-15312268 CCTCCACGCTCTCTCTCTCCTGC No data
Right 1176975120 21:15312262-15312284 CTCCTGCTGCCTTGTAAAGAGGG 0: 17
1: 267
2: 864
3: 1458
4: 2288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176975120 Original CRISPR CTCCTGCTGCCTTGTAAAGA GGG Intergenic
Too many off-targets to display for this crispr