ID: 1176979662

View in Genome Browser
Species Human (GRCh38)
Location 21:15366477-15366499
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176979660_1176979662 2 Left 1176979660 21:15366452-15366474 CCTGACAGCTACTGTACATAATT No data
Right 1176979662 21:15366477-15366499 CTTTTTCAGTAAATGTATCTGGG No data
1176979659_1176979662 14 Left 1176979659 21:15366440-15366462 CCTTTGTCTGGGCCTGACAGCTA No data
Right 1176979662 21:15366477-15366499 CTTTTTCAGTAAATGTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176979662 Original CRISPR CTTTTTCAGTAAATGTATCT GGG Intergenic
No off target data available for this crispr