ID: 1176983385

View in Genome Browser
Species Human (GRCh38)
Location 21:15408511-15408533
Sequence TAGGGTCAACATAAGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176983378_1176983385 23 Left 1176983378 21:15408465-15408487 CCTGATAGGCAAACATCTCATTT No data
Right 1176983385 21:15408511-15408533 TAGGGTCAACATAAGGTGGTTGG No data
1176983381_1176983385 -6 Left 1176983381 21:15408494-15408516 CCTTTGTGTACCTGAAATAGGGT No data
Right 1176983385 21:15408511-15408533 TAGGGTCAACATAAGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176983385 Original CRISPR TAGGGTCAACATAAGGTGGT TGG Intergenic
No off target data available for this crispr