ID: 1176983414

View in Genome Browser
Species Human (GRCh38)
Location 21:15408767-15408789
Sequence CATGTTTCCCAGCACCCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176983414_1176983418 -5 Left 1176983414 21:15408767-15408789 CCTATGGGGTGCTGGGAAACATG No data
Right 1176983418 21:15408785-15408807 ACATGAGGAAGGCTGGCAAATGG No data
1176983414_1176983422 28 Left 1176983414 21:15408767-15408789 CCTATGGGGTGCTGGGAAACATG No data
Right 1176983422 21:15408818-15408840 ATCATACAAGACTGAGGGTTAGG No data
1176983414_1176983419 -4 Left 1176983414 21:15408767-15408789 CCTATGGGGTGCTGGGAAACATG No data
Right 1176983419 21:15408786-15408808 CATGAGGAAGGCTGGCAAATGGG No data
1176983414_1176983421 23 Left 1176983414 21:15408767-15408789 CCTATGGGGTGCTGGGAAACATG No data
Right 1176983421 21:15408813-15408835 AAGACATCATACAAGACTGAGGG No data
1176983414_1176983420 22 Left 1176983414 21:15408767-15408789 CCTATGGGGTGCTGGGAAACATG No data
Right 1176983420 21:15408812-15408834 AAAGACATCATACAAGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176983414 Original CRISPR CATGTTTCCCAGCACCCCAT AGG (reversed) Intergenic
No off target data available for this crispr