ID: 1176983418

View in Genome Browser
Species Human (GRCh38)
Location 21:15408785-15408807
Sequence ACATGAGGAAGGCTGGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176983406_1176983418 27 Left 1176983406 21:15408735-15408757 CCATAAGTAGCAAGCATTTATCT No data
Right 1176983418 21:15408785-15408807 ACATGAGGAAGGCTGGCAAATGG No data
1176983412_1176983418 -3 Left 1176983412 21:15408765-15408787 CCCCTATGGGGTGCTGGGAAACA No data
Right 1176983418 21:15408785-15408807 ACATGAGGAAGGCTGGCAAATGG No data
1176983414_1176983418 -5 Left 1176983414 21:15408767-15408789 CCTATGGGGTGCTGGGAAACATG No data
Right 1176983418 21:15408785-15408807 ACATGAGGAAGGCTGGCAAATGG No data
1176983413_1176983418 -4 Left 1176983413 21:15408766-15408788 CCCTATGGGGTGCTGGGAAACAT No data
Right 1176983418 21:15408785-15408807 ACATGAGGAAGGCTGGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176983418 Original CRISPR ACATGAGGAAGGCTGGCAAA TGG Intergenic
No off target data available for this crispr