ID: 1176984358

View in Genome Browser
Species Human (GRCh38)
Location 21:15419393-15419415
Sequence TATACTCTTGGGATCACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176984358_1176984363 -9 Left 1176984358 21:15419393-15419415 CCTGCTGTGATCCCAAGAGTATA No data
Right 1176984363 21:15419407-15419429 AAGAGTATAGCAGGCGGTTGAGG No data
1176984358_1176984365 20 Left 1176984358 21:15419393-15419415 CCTGCTGTGATCCCAAGAGTATA No data
Right 1176984365 21:15419436-15419458 ACCAATTAATGAGGTTCAAATGG No data
1176984358_1176984364 11 Left 1176984358 21:15419393-15419415 CCTGCTGTGATCCCAAGAGTATA No data
Right 1176984364 21:15419427-15419449 AGGTTAAAAACCAATTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176984358 Original CRISPR TATACTCTTGGGATCACAGC AGG (reversed) Intergenic
No off target data available for this crispr