ID: 1176984412

View in Genome Browser
Species Human (GRCh38)
Location 21:15419879-15419901
Sequence CTCGTAAGAAGCAGCAGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176984409_1176984412 12 Left 1176984409 21:15419844-15419866 CCCTCAAAGTCTGAATTTCTAGG No data
Right 1176984412 21:15419879-15419901 CTCGTAAGAAGCAGCAGTCTAGG No data
1176984408_1176984412 23 Left 1176984408 21:15419833-15419855 CCTGATCTAATCCCTCAAAGTCT No data
Right 1176984412 21:15419879-15419901 CTCGTAAGAAGCAGCAGTCTAGG No data
1176984411_1176984412 11 Left 1176984411 21:15419845-15419867 CCTCAAAGTCTGAATTTCTAGGT No data
Right 1176984412 21:15419879-15419901 CTCGTAAGAAGCAGCAGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176984412 Original CRISPR CTCGTAAGAAGCAGCAGTCT AGG Intergenic
No off target data available for this crispr