ID: 1176989609

View in Genome Browser
Species Human (GRCh38)
Location 21:15479583-15479605
Sequence CCATTGGCATGCAGCATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176989609_1176989614 28 Left 1176989609 21:15479583-15479605 CCTTCTATGCTGCATGCCAATGG No data
Right 1176989614 21:15479634-15479656 TGTTCTATGAAGCCCAGGCCAGG No data
1176989609_1176989612 -7 Left 1176989609 21:15479583-15479605 CCTTCTATGCTGCATGCCAATGG No data
Right 1176989612 21:15479599-15479621 CCAATGGCAGACAATGTTAAAGG No data
1176989609_1176989613 23 Left 1176989609 21:15479583-15479605 CCTTCTATGCTGCATGCCAATGG No data
Right 1176989613 21:15479629-15479651 CTCTCTGTTCTATGAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176989609 Original CRISPR CCATTGGCATGCAGCATAGA AGG (reversed) Intergenic
No off target data available for this crispr