ID: 1176992235

View in Genome Browser
Species Human (GRCh38)
Location 21:15511130-15511152
Sequence ACCTGCTTCTGAACTGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176992235_1176992238 19 Left 1176992235 21:15511130-15511152 CCAGTATCAGTTCAGAAGCAGGT No data
Right 1176992238 21:15511172-15511194 TTTGAGTAGCACTGGCTTAGCGG No data
1176992235_1176992237 11 Left 1176992235 21:15511130-15511152 CCAGTATCAGTTCAGAAGCAGGT No data
Right 1176992237 21:15511164-15511186 AATCACATTTTGAGTAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176992235 Original CRISPR ACCTGCTTCTGAACTGATAC TGG (reversed) Intergenic
No off target data available for this crispr