ID: 1176998157

View in Genome Browser
Species Human (GRCh38)
Location 21:15580155-15580177
Sequence AGTTATCTGCAGAAGACGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176998157_1176998164 25 Left 1176998157 21:15580155-15580177 CCTGCCGTCTTCTGCAGATAACT No data
Right 1176998164 21:15580203-15580225 GGCCTGTTACTGGGCTTCGGTGG No data
1176998157_1176998163 22 Left 1176998157 21:15580155-15580177 CCTGCCGTCTTCTGCAGATAACT No data
Right 1176998163 21:15580200-15580222 CTTGGCCTGTTACTGGGCTTCGG 0: 169
1: 171
2: 103
3: 76
4: 232
1176998157_1176998162 16 Left 1176998157 21:15580155-15580177 CCTGCCGTCTTCTGCAGATAACT No data
Right 1176998162 21:15580194-15580216 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
1176998157_1176998161 15 Left 1176998157 21:15580155-15580177 CCTGCCGTCTTCTGCAGATAACT No data
Right 1176998161 21:15580193-15580215 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
1176998157_1176998159 4 Left 1176998157 21:15580155-15580177 CCTGCCGTCTTCTGCAGATAACT No data
Right 1176998159 21:15580182-15580204 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176998157 Original CRISPR AGTTATCTGCAGAAGACGGC AGG (reversed) Intergenic
No off target data available for this crispr