ID: 1176998164

View in Genome Browser
Species Human (GRCh38)
Location 21:15580203-15580225
Sequence GGCCTGTTACTGGGCTTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176998158_1176998164 21 Left 1176998158 21:15580159-15580181 CCGTCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 1176998164 21:15580203-15580225 GGCCTGTTACTGGGCTTCGGTGG No data
1176998160_1176998164 -3 Left 1176998160 21:15580183-15580205 CCTTTTGAGAGACAGCTCTTGGC 0: 173
1: 182
2: 165
3: 95
4: 236
Right 1176998164 21:15580203-15580225 GGCCTGTTACTGGGCTTCGGTGG No data
1176998157_1176998164 25 Left 1176998157 21:15580155-15580177 CCTGCCGTCTTCTGCAGATAACT No data
Right 1176998164 21:15580203-15580225 GGCCTGTTACTGGGCTTCGGTGG No data
1176998156_1176998164 26 Left 1176998156 21:15580154-15580176 CCCTGCCGTCTTCTGCAGATAAC No data
Right 1176998164 21:15580203-15580225 GGCCTGTTACTGGGCTTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176998164 Original CRISPR GGCCTGTTACTGGGCTTCGG TGG Intergenic
No off target data available for this crispr