ID: 1177003253 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:15639353-15639375 |
Sequence | CTGTAGACAGAGTGCTGGCT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1177003253_1177003259 | 18 | Left | 1177003253 | 21:15639353-15639375 | CCCAGCCAGCACTCTGTCTACAG | No data | ||
Right | 1177003259 | 21:15639394-15639416 | GGTTCCTCTGGCAGCGTGACTGG | No data | ||||
1177003253_1177003258 | 6 | Left | 1177003253 | 21:15639353-15639375 | CCCAGCCAGCACTCTGTCTACAG | No data | ||
Right | 1177003258 | 21:15639382-15639404 | AACAGCACAGCTGGTTCCTCTGG | No data | ||||
1177003253_1177003257 | -3 | Left | 1177003253 | 21:15639353-15639375 | CCCAGCCAGCACTCTGTCTACAG | No data | ||
Right | 1177003257 | 21:15639373-15639395 | CAGGAGCTAAACAGCACAGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1177003253 | Original CRISPR | CTGTAGACAGAGTGCTGGCT GGG (reversed) | Intergenic | ||
No off target data available for this crispr |