ID: 1177003253

View in Genome Browser
Species Human (GRCh38)
Location 21:15639353-15639375
Sequence CTGTAGACAGAGTGCTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177003253_1177003259 18 Left 1177003253 21:15639353-15639375 CCCAGCCAGCACTCTGTCTACAG No data
Right 1177003259 21:15639394-15639416 GGTTCCTCTGGCAGCGTGACTGG No data
1177003253_1177003258 6 Left 1177003253 21:15639353-15639375 CCCAGCCAGCACTCTGTCTACAG No data
Right 1177003258 21:15639382-15639404 AACAGCACAGCTGGTTCCTCTGG No data
1177003253_1177003257 -3 Left 1177003253 21:15639353-15639375 CCCAGCCAGCACTCTGTCTACAG No data
Right 1177003257 21:15639373-15639395 CAGGAGCTAAACAGCACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177003253 Original CRISPR CTGTAGACAGAGTGCTGGCT GGG (reversed) Intergenic
No off target data available for this crispr