ID: 1177003991

View in Genome Browser
Species Human (GRCh38)
Location 21:15648268-15648290
Sequence TACAGCTACTACCTCTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177003988_1177003991 15 Left 1177003988 21:15648230-15648252 CCTATAAAGAAAAGCAAAGGAAT No data
Right 1177003991 21:15648268-15648290 TACAGCTACTACCTCTATGGAGG No data
1177003986_1177003991 25 Left 1177003986 21:15648220-15648242 CCAATAGAAACCTATAAAGAAAA No data
Right 1177003991 21:15648268-15648290 TACAGCTACTACCTCTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177003991 Original CRISPR TACAGCTACTACCTCTATGG AGG Intergenic
No off target data available for this crispr