ID: 1177005684

View in Genome Browser
Species Human (GRCh38)
Location 21:15669482-15669504
Sequence CTCACAAACAGATTGCAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177005684_1177005690 0 Left 1177005684 21:15669482-15669504 CCCAACTGCAATCTGTTTGTGAG No data
Right 1177005690 21:15669505-15669527 ATGGGTGTTAAAATGCTTTGGGG No data
1177005684_1177005689 -1 Left 1177005684 21:15669482-15669504 CCCAACTGCAATCTGTTTGTGAG No data
Right 1177005689 21:15669504-15669526 GATGGGTGTTAAAATGCTTTGGG No data
1177005684_1177005692 26 Left 1177005684 21:15669482-15669504 CCCAACTGCAATCTGTTTGTGAG No data
Right 1177005692 21:15669531-15669553 CTCCCACTACTCCTGATTATAGG No data
1177005684_1177005688 -2 Left 1177005684 21:15669482-15669504 CCCAACTGCAATCTGTTTGTGAG No data
Right 1177005688 21:15669503-15669525 AGATGGGTGTTAAAATGCTTTGG No data
1177005684_1177005693 27 Left 1177005684 21:15669482-15669504 CCCAACTGCAATCTGTTTGTGAG No data
Right 1177005693 21:15669532-15669554 TCCCACTACTCCTGATTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177005684 Original CRISPR CTCACAAACAGATTGCAGTT GGG (reversed) Intergenic
No off target data available for this crispr