ID: 1177005688

View in Genome Browser
Species Human (GRCh38)
Location 21:15669503-15669525
Sequence AGATGGGTGTTAAAATGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177005684_1177005688 -2 Left 1177005684 21:15669482-15669504 CCCAACTGCAATCTGTTTGTGAG No data
Right 1177005688 21:15669503-15669525 AGATGGGTGTTAAAATGCTTTGG No data
1177005685_1177005688 -3 Left 1177005685 21:15669483-15669505 CCAACTGCAATCTGTTTGTGAGA No data
Right 1177005688 21:15669503-15669525 AGATGGGTGTTAAAATGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177005688 Original CRISPR AGATGGGTGTTAAAATGCTT TGG Intergenic
No off target data available for this crispr