ID: 1177005692 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:15669531-15669553 |
Sequence | CTCCCACTACTCCTGATTAT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1177005684_1177005692 | 26 | Left | 1177005684 | 21:15669482-15669504 | CCCAACTGCAATCTGTTTGTGAG | No data | ||
Right | 1177005692 | 21:15669531-15669553 | CTCCCACTACTCCTGATTATAGG | No data | ||||
1177005685_1177005692 | 25 | Left | 1177005685 | 21:15669483-15669505 | CCAACTGCAATCTGTTTGTGAGA | No data | ||
Right | 1177005692 | 21:15669531-15669553 | CTCCCACTACTCCTGATTATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1177005692 | Original CRISPR | CTCCCACTACTCCTGATTAT AGG | Intergenic | ||
No off target data available for this crispr |