ID: 1177006999

View in Genome Browser
Species Human (GRCh38)
Location 21:15685944-15685966
Sequence GAGAAGGAAGCTCCTGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177006996_1177006999 24 Left 1177006996 21:15685897-15685919 CCATGGAATGTGGGGAAGGGAGA No data
Right 1177006999 21:15685944-15685966 GAGAAGGAAGCTCCTGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177006999 Original CRISPR GAGAAGGAAGCTCCTGCAAA TGG Intergenic
No off target data available for this crispr