ID: 1177009735

View in Genome Browser
Species Human (GRCh38)
Location 21:15717338-15717360
Sequence AAGGTGCCTGCACTTTGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177009735_1177009737 1 Left 1177009735 21:15717338-15717360 CCTCTACAAAGTGCAGGCACCTT No data
Right 1177009737 21:15717362-15717384 TAGAAATAGACTTATTTTGATGG No data
1177009735_1177009738 9 Left 1177009735 21:15717338-15717360 CCTCTACAAAGTGCAGGCACCTT No data
Right 1177009738 21:15717370-15717392 GACTTATTTTGATGGTATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177009735 Original CRISPR AAGGTGCCTGCACTTTGTAG AGG (reversed) Intergenic
No off target data available for this crispr