ID: 1177011076

View in Genome Browser
Species Human (GRCh38)
Location 21:15730464-15730486
Sequence GCCCCACTTCTCCTTCCGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177011072_1177011076 -9 Left 1177011072 21:15730450-15730472 CCGCCAGCCGGCGGGCCCCACTT 0: 1
1: 0
2: 1
3: 9
4: 129
Right 1177011076 21:15730464-15730486 GCCCCACTTCTCCTTCCGACGGG 0: 1
1: 0
2: 0
3: 14
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177011076 Original CRISPR GCCCCACTTCTCCTTCCGAC GGG Intronic
900936885 1:5771635-5771657 GCCCCACCTCTGGTTCCCACTGG - Intergenic
901049970 1:6421021-6421043 GCCCCACGTCTCCCTCCTTCAGG + Intronic
901475515 1:9486639-9486661 CCCCAACTTCTCCTTCCATCTGG + Intergenic
903777287 1:25800793-25800815 TCCCCACTCCGCCTTCCGCCTGG - Intronic
904794703 1:33050740-33050762 GCCCCATTACTCCTTCCTGCTGG - Intronic
905010085 1:34741464-34741486 GCCCCTCTTCCCCTTCCCACCGG - Intronic
905934559 1:41813216-41813238 GTCCCACTTCTGCTTCTTACTGG - Intronic
906708048 1:47909345-47909367 GGTCCCCTTCTCCTTCCGCCAGG - Intronic
906843723 1:49167534-49167556 GCTCCACTGCTCCTTCCCAAAGG + Intronic
909124962 1:71656284-71656306 GCCCCTATTCTCCTTCTAACAGG + Intronic
909491361 1:76229877-76229899 GCCCCTCTGCTCCTCCCTACTGG - Intronic
911231347 1:95364783-95364805 GCCCCACTCCTCCTGCCCTCTGG - Intergenic
911981121 1:104568470-104568492 GCACCAGTTGTCCTTCCCACAGG + Intergenic
915745004 1:158149290-158149312 TCCCTACCTCTCCTTCCAACTGG + Intergenic
915832908 1:159147410-159147432 GCCCCACTTCCCATTCAGCCTGG + Intergenic
916028496 1:160855961-160855983 GCCCCACACCTTCCTCCGACTGG - Intronic
916552146 1:165859519-165859541 GCCCCACTGATCTTTCTGACAGG - Intronic
918447643 1:184630961-184630983 CTCCCATTTCTCCTTCCCACTGG + Intergenic
924616687 1:245617899-245617921 TCCCCCCTGCTCCTTCCCACAGG + Intronic
1063227978 10:4034089-4034111 GCCCCTCTTCTCCTTCGTATTGG + Intergenic
1064083043 10:12323855-12323877 ACTCCACTTCTGCTTCTGACTGG + Intergenic
1066195188 10:33092338-33092360 GTCCCACTTCCCCTTCCCAATGG + Intergenic
1066694863 10:38068732-38068754 TCCCCTCTTCTCCTTCCTCCAGG - Intergenic
1066997648 10:42578450-42578472 TCCCCTCTTCTCCTTCCTCCAGG + Intronic
1068097401 10:52509445-52509467 GCCCGCCTTCGCCTTCCGAAGGG + Intergenic
1071902043 10:90131238-90131260 TCCCCATTTCTCCTTCCCTCCGG - Intergenic
1073541940 10:104322035-104322057 GCCCCACATCTCATTCTGTCTGG - Intronic
1083292193 11:61696425-61696447 GCCCCACTGCTCCTCCCCGCTGG - Intronic
1084116172 11:67044364-67044386 GCCCCACTCCTCCCTTCCACCGG - Intronic
1084396785 11:68916335-68916357 ACCCTACTTCTCCAGCCGACTGG - Intronic
1087249327 11:95878699-95878721 GCCCCACTTCTCCATCCATAAGG + Intronic
1089947035 11:122486832-122486854 ACCTCATTTCTCCTTCCGAGTGG + Intergenic
1090265612 11:125351262-125351284 GCCCCCTTTCTCCTGCCCACAGG + Exonic
1091579930 12:1779080-1779102 GCCCCATTTCACATTCCTACTGG - Intronic
1094035305 12:26063995-26064017 GCCCCACTTCTCCTCCTGAAAGG - Intronic
1096179035 12:49540526-49540548 GCCCCACCTCTACTTCTGCCAGG - Intronic
1098358068 12:69629727-69629749 GCCTCACTGCTCCTTCCATCTGG + Intergenic
1102300114 12:111765677-111765699 GCCCCACTTCCCCTTCCCAATGG - Intronic
1104569082 12:129909383-129909405 GCCCCTGTTCTGCTTCCCACTGG + Intergenic
1106917045 13:34526934-34526956 CCCTCACTACTCCTTCCCACAGG - Intergenic
1107339907 13:39395021-39395043 TCCCCACTGCTCCTTCCCACGGG + Intronic
1110550048 13:76801962-76801984 CACCCACTTCTCCTTCCTATAGG + Intergenic
1117201854 14:53398525-53398547 TCACCACTTCTCTTTCCAACTGG - Intergenic
1119175394 14:72564705-72564727 TGCCCCCTTCTCCTTCTGACTGG + Intronic
1123676683 15:22715646-22715668 CCCCCACTTCACCTTCGGAGAGG + Intergenic
1129760986 15:78129238-78129260 GCCCCACATCTCCTACCCTCTGG - Intronic
1130136275 15:81184381-81184403 GCCCAACTTCTCCATCTGTCTGG - Intronic
1132534562 16:471614-471636 ACCCCACTTCTGCTGGCGACAGG - Intronic
1132999539 16:2842018-2842040 GCCCCACCCATCCTTCCGGCAGG + Intergenic
1134022232 16:10929267-10929289 CCCCCACTTCACCTTCGGAGAGG - Exonic
1135536152 16:23296094-23296116 GCCCGACTTCTCCTTCAGCCCGG - Intronic
1137723538 16:50641832-50641854 GCCCCACTCCTCCTTTAGATGGG + Intergenic
1139451412 16:67030145-67030167 GCTCCACTTCTTTTTCCGAATGG - Intronic
1142129704 16:88427101-88427123 GCCCCTCTTCTCCCTAAGACAGG + Intergenic
1142345975 16:89554220-89554242 GGCCCACATGTCCTTCAGACTGG + Intronic
1142562028 17:815883-815905 GCCCCTCTTATCCTCCCTACTGG - Intronic
1144198527 17:12918251-12918273 GTTACACTTCTCCTTCCTACTGG + Intronic
1148192416 17:45688888-45688910 GCCTCACTTTTCCTTCCCTCAGG + Intergenic
1149863712 17:60138948-60138970 GCCCCGCGCCTCATTCCGACTGG + Intergenic
1151597672 17:75088132-75088154 GCCCCAGGTCTCCTCCCGCCTGG + Intronic
1151989919 17:77567810-77567832 GCCCCATTTCACATTCCTACAGG - Intergenic
1152478212 17:80532315-80532337 GCCCCACTGCTCCCTCCATCTGG + Intergenic
1152658983 17:81533801-81533823 GCCCCACACCCCCTTCAGACAGG - Intronic
1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG + Intronic
1160366189 18:78327840-78327862 GCCCCACTTCTCCTCACTGCCGG + Intergenic
1160780586 19:876334-876356 CTCCCTCCTCTCCTTCCGACGGG + Intronic
1160996134 19:1882788-1882810 ACCACGCTTCTCCTTCAGACTGG + Intronic
1161196847 19:2991634-2991656 GCCTCCCTTCTCCGTCCGCCTGG - Intronic
1163559346 19:18009761-18009783 GCCCCACTGCTCCTTGCTGCAGG + Exonic
1164917649 19:32064961-32064983 CCCACACTTCACCTTCTGACAGG + Intergenic
1166345216 19:42161495-42161517 TCCTCACTCCTCCTTCCTACAGG - Intronic
1166511211 19:43410180-43410202 GCTCCAGTTCTCCTACCAACAGG - Intronic
1167198698 19:48049043-48049065 GCCCCCCTTCCCCTTCCACCAGG + Intronic
1167265431 19:48480728-48480750 TCCCCACTTCTCTTTCCCACAGG + Intronic
1167392300 19:49203614-49203636 TCCCCACTTCCCCTCCCCACAGG + Intronic
1167596571 19:50431593-50431615 TCCCCGCTTCCCCTTCCGTCTGG + Intergenic
925883135 2:8369597-8369619 CCTCCACTTCTCCTTCTGACTGG - Intergenic
927110477 2:19860837-19860859 GCCCTCCTTCTCCTTCCTCCAGG + Intergenic
929561481 2:42959192-42959214 GCCCCACTGCTCCATCACACTGG + Intergenic
932449848 2:71802437-71802459 GCCCCACATGTCCTCCCGAGAGG + Intergenic
937192858 2:120121348-120121370 CCCCCACTCCCCCTCCCGACAGG + Intronic
937446454 2:121962724-121962746 GCCCCTCTTCTGCTTCAGCCAGG - Intergenic
942530232 2:176902122-176902144 GTCCCACCTCTGCTTCCTACTGG + Intergenic
948269731 2:236665022-236665044 CCCCGACATCTCCTTCTGACTGG + Intergenic
948571927 2:238923030-238923052 CCCCCACTTCTCCTGCCTGCAGG - Intergenic
948723819 2:239919856-239919878 GCCCCACCCCTCCTTCCGTAGGG - Intronic
948730684 2:239961898-239961920 GCCCCACTTCTCCCACCATCTGG + Intronic
948805944 2:240453481-240453503 GCCCCCCTTCCTCTTCCGCCAGG + Intronic
1169860823 20:10150586-10150608 GCCCCCCTTCACCTTCCACCAGG - Intergenic
1170453376 20:16508969-16508991 TCCCCACTTCCCCTTCTGTCAGG + Intronic
1170456868 20:16541753-16541775 GCTCCACTTCTCCCTCTGCCTGG - Intronic
1173369291 20:42420503-42420525 GCCTCCCTTCTCCTTACGCCAGG + Intronic
1175524468 20:59624007-59624029 CCCCCACTTCTCCTGCCAGCAGG - Intronic
1177011076 21:15730464-15730486 GCCCCACTTCTCCTTCCGACGGG + Intronic
1178388790 21:32181495-32181517 GCCTCATTTCTCCTTCTCACTGG - Intergenic
1179525063 21:41970791-41970813 GCCCCACTGCTCCTTCTGCCAGG - Intergenic
1179525890 21:41975613-41975635 ACCCCACGTCTCCTTGGGACAGG - Intergenic
1181235539 22:21445893-21445915 GCCCCACTCCTTCTTCCGAGTGG - Exonic
1183623365 22:38987355-38987377 GCCCCACTGCTGCTTCTGAATGG + Intronic
1183628967 22:39021707-39021729 GCCCCACTGCTGCTTCTGAATGG + Intronic
1183630175 22:39027812-39027834 GCCCCACTGCTGCTTCTGAATGG + Intronic
1183638214 22:39077552-39077574 GCCCCACTGCTGCTTCTGAATGG + Intronic
1184032931 22:41905418-41905440 GACACACATCTCCTTCCCACAGG + Exonic
1184596499 22:45517225-45517247 GCACCACTTTTCCTTCCTAATGG - Intronic
1184825644 22:46949002-46949024 GCTCCACTCCTGCTTCCCACAGG - Intronic
1185359940 22:50400093-50400115 GACCCACTGCTGCTTCCCACTGG - Intronic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
950695925 3:14701176-14701198 CCCCCACTTCTCCTGCCAACAGG - Intronic
960292784 3:115906584-115906606 GTCCCATTTCTCTTTCCTACTGG + Intronic
963603283 3:147394903-147394925 GCCCCACTTCTCCTACTGCCCGG - Intronic
968519014 4:1027378-1027400 GCCCCACCCCTCCTGCTGACCGG - Intergenic
970867994 4:20781166-20781188 GCACCATTTCATCTTCCGACTGG - Intronic
972632780 4:40856792-40856814 GCCTCACTCCTTCTTCCCACCGG + Intronic
986826936 5:11532213-11532235 GCCCAACTTCTCCCTCTGCCAGG + Intronic
992564886 5:77986955-77986977 GCCCCACATCTCCTTCAGGCAGG - Intergenic
994953498 5:106497272-106497294 GCCTCACTCCTCTTTCCGCCTGG + Intergenic
998059269 5:139106271-139106293 CAGCCACTTCTCCTTCCCACTGG + Intronic
1000324969 5:160165267-160165289 GCCCCGGATGTCCTTCCGACTGG + Intergenic
1000368486 5:160512426-160512448 GGCCCACTTCTTCTTCCACCCGG + Intergenic
1015208712 6:130671616-130671638 GCCCCACTTGATCTTCCCACAGG - Intergenic
1018199087 6:161378871-161378893 GCCCCACTTCTCACTCCCAGTGG + Intronic
1019464671 7:1181144-1181166 GCCCCACGTCTCCTTCAGGCAGG + Intergenic
1022878938 7:34565694-34565716 GCTCCCCTTCACCTTCCGTCAGG - Intergenic
1023244302 7:38184263-38184285 GCCCCAGTTCTCCCTCTGCCTGG - Intronic
1023414278 7:39917656-39917678 TCCCCAGATCTCCTTCCCACTGG + Intergenic
1029864938 7:103617961-103617983 GCTCCCCTTCTCCTTCTGCCAGG + Intronic
1031966752 7:128032456-128032478 ACCCAACTGCTCCCTCCGACCGG - Intronic
1032689203 7:134265828-134265850 GAACCTCTTCTCCTTCCCACTGG + Intergenic
1035783330 8:2245430-2245452 GCCCCACATCACCTTGCTACTGG - Intergenic
1042560436 8:70069641-70069663 GCCCCCCTTCCCCTTCCGGATGG - Exonic
1047516700 8:125561189-125561211 ACCCCAATTCTACTTCCCACAGG + Intergenic
1047902973 8:129443854-129443876 GTCACTCTTCTCCTTCCCACAGG + Intergenic
1052147238 9:25064552-25064574 GCACCACTTCACATTCCTACTGG + Intergenic
1060295513 9:122340553-122340575 GCACCACTTGACCTTCCGAAGGG + Intergenic
1188388525 X:29591495-29591517 CCCCCTCTGCTCCTCCCGACTGG - Intronic
1189164950 X:38851762-38851784 CCCCCACCTCACCTTCCGACAGG + Intergenic
1192804214 X:74495382-74495404 GCCTCACCTCTCCCTCCCACAGG + Intronic
1195129097 X:101837345-101837367 CCCCCACTGCTCCCTCCCACTGG - Intronic
1195201031 X:102550216-102550238 CCCCCACTGCTCCTTCCCCCTGG + Intergenic
1195967157 X:110439133-110439155 GCCCCTCTTGTCCTTCTGTCGGG - Intronic
1197726158 X:129777747-129777769 ACCCCAGATCTCCTTCCCACTGG - Intergenic
1199693140 X:150324442-150324464 GCCCCACATCACATTCCCACCGG + Intergenic