ID: 1177015977

View in Genome Browser
Species Human (GRCh38)
Location 21:15787802-15787824
Sequence AGCTCACCTAAGCCCCTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177015977_1177015980 12 Left 1177015977 21:15787802-15787824 CCAAAAAGGGGCTTAGGTGAGCT 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1177015980 21:15787837-15787859 ATTTTCAGTATTACTGCTATAGG 0: 1
1: 0
2: 1
3: 21
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177015977 Original CRISPR AGCTCACCTAAGCCCCTTTT TGG (reversed) Intronic
900469528 1:2846790-2846812 AGAACTCCTAAGCCCCTCTTTGG - Intergenic
905856072 1:41315021-41315043 AGCTCAAATAATCGCCTTTTGGG - Intergenic
909272060 1:73635366-73635388 AGCTGAACTAAGCCCATTTAAGG + Intergenic
911404270 1:97416816-97416838 TGCTCATCGAACCCCCTTTTAGG + Intronic
920559563 1:206929701-206929723 TGCTCACCTCTGCCCCTATTGGG - Exonic
920626096 1:207601618-207601640 AACTGACTTCAGCCCCTTTTAGG - Intronic
1065397896 10:25260695-25260717 ACAAAACCTAAGCCCCTTTTAGG - Intronic
1068453526 10:57225165-57225187 AGTTCTTCTAAGCTCCTTTTAGG - Intergenic
1071437409 10:85660207-85660229 AGCCCACCTATGCCCCAGTTAGG + Intronic
1078202250 11:9194111-9194133 AGCTCACATAAGCTCCTTATAGG - Intronic
1083502032 11:63118103-63118125 GGCTCCCCTAAGACCCTATTTGG - Intronic
1083615165 11:64022465-64022487 CGCTCCCCTAAGCCCCCTGTGGG - Intronic
1085338800 11:75718082-75718104 AGCGCAACAAAGCCCCCTTTAGG - Intronic
1088963204 11:114691752-114691774 AGCTCACCAAAGCCCCCCTTGGG - Intronic
1090898835 11:131006770-131006792 ATCTCTCTTAATCCCCTTTTAGG + Intergenic
1092552418 12:9517629-9517651 ATCTCACCAAAGCACTTTTTCGG + Intergenic
1094006067 12:25752908-25752930 GGCTCACCTAAGTGCCTTTTGGG - Intergenic
1094519703 12:31172982-31173004 ATCTCACCAAAGCACTTTTTCGG - Intergenic
1096155522 12:49339424-49339446 CCCTCACCTCAGCCCCTTTCAGG + Intergenic
1097629295 12:62040252-62040274 TTCTGACCTCAGCCCCTTTTGGG - Intronic
1097637867 12:62144413-62144435 AGGTCACCTAAGCCCCATGAAGG + Intronic
1102590625 12:113954218-113954240 AGCTCACTGAAGCCTCTTCTTGG - Intronic
1102923327 12:116808965-116808987 AGCTGCCATCAGCCCCTTTTAGG + Intronic
1104332354 12:127858600-127858622 AGCTCACCTCTGCCACTGTTCGG - Intergenic
1108447656 13:50525849-50525871 AGAACACCTAAGCCCCTGGTGGG + Intronic
1108887116 13:55200078-55200100 AGCCCACCAAAGCACCTCTTGGG - Intergenic
1110826126 13:79974278-79974300 AGCTCACCAAAGCTCCCCTTGGG - Intergenic
1118934879 14:70278536-70278558 AGCTCTCCGAAGCTTCTTTTAGG - Intergenic
1119886237 14:78145209-78145231 AGCTCATCTAAGCTGCTTCTGGG + Intergenic
1121288075 14:92752070-92752092 TGCTGGCCTAAGCCTCTTTTGGG - Intergenic
1121869453 14:97393911-97393933 TCCTCACCTAAGCCCTTTGTAGG + Intergenic
1121942199 14:98081766-98081788 AGCTCAGTTAAGACCCATTTTGG + Intergenic
1122836144 14:104432037-104432059 TGCTCACCTGAGCCCCTCCTTGG - Intergenic
1202859512 14_GL000225v1_random:72602-72624 AGCTCACGAAAGCCCCCTGTGGG + Intergenic
1123467565 15:20528132-20528154 GGCTCTCCTGCGCCCCTTTTTGG + Intergenic
1123650549 15:22472910-22472932 GGCTCTCCTGCGCCCCTTTTTGG - Intergenic
1123740957 15:23281752-23281774 GGCTCTCCTGCGCCCCTTTTTGG - Intergenic
1123746041 15:23320806-23320828 GGCTCTCCTGCGCCCCTTTTTGG + Intergenic
1128372554 15:67050887-67050909 AGCAGATCTAAGCCCGTTTTAGG - Intergenic
1128411525 15:67403715-67403737 AGCTCACCTAAGACAGTTTAGGG + Intronic
1128891163 15:71333025-71333047 AGCTCACCTAGACTCCATTTGGG + Intronic
1129889704 15:79063830-79063852 AGCTGAACTGAGTCCCTTTTGGG - Intronic
1134530561 16:14979657-14979679 AGCACAACTCAGCCCATTTTTGG + Intronic
1138008258 16:53356840-53356862 GGCTCTCCTGTGCCCCTTTTTGG + Intergenic
1139865783 16:70061309-70061331 AGCACAACTTAGCCCATTTTTGG - Intergenic
1140713243 16:77697455-77697477 AGCCCAGTGAAGCCCCTTTTGGG + Intergenic
1141000918 16:80307155-80307177 AGGTCAGCTAAGCCCATTTGGGG - Intergenic
1143905404 17:10205006-10205028 AACTCATCTAATCCCCTTCTAGG + Intergenic
1145755140 17:27384803-27384825 AGCTCACCCAATCCCCCATTTGG - Intergenic
1145793791 17:27644120-27644142 AGCTCACTCAAGGCCCTCTTGGG + Intronic
1146806515 17:35869112-35869134 AGCTCAAGTAAGCCCATGTTAGG + Intergenic
1151213051 17:72559164-72559186 AGCTCATCTGAGCCCCTGTGGGG - Intergenic
1154009700 18:10564413-10564435 GGCTCACCTCATCCCTTTTTTGG + Intergenic
1158007202 18:52686300-52686322 AGCTCACCAGAATCCCTTTTAGG + Intronic
1158045026 18:53145445-53145467 AGCTCCCTTCAGCCCATTTTAGG - Intronic
1158277476 18:55783612-55783634 AGCTCACCTTAAATCCTTTTGGG - Intergenic
1161761064 19:6173110-6173132 AGCCCACCAAAGCCCCCCTTGGG - Intronic
1165114070 19:33518494-33518516 AGTTCACCTTTGCCTCTTTTTGG + Intronic
1167620569 19:50557717-50557739 AGCTCACCTCAGCCCTTCCTGGG - Intronic
925017863 2:545366-545388 GGCTCACCTCAGCCTCTTTCTGG + Intergenic
926199839 2:10786747-10786769 AGCTCACCTAATCATCTTTTAGG - Intronic
926758773 2:16257975-16257997 AGCTCACCTAAATGCCTTTTAGG - Intergenic
927694939 2:25233214-25233236 ACCTCATCTAGCCCCCTTTTTGG + Exonic
929283189 2:40105791-40105813 ACCTCAGCTCAGCCCCTTGTCGG - Intronic
932366677 2:71157430-71157452 GGCTCCCCCACGCCCCTTTTTGG - Intergenic
932376035 2:71236836-71236858 AGCTCACAGAAACCTCTTTTCGG - Intergenic
935856327 2:107278645-107278667 AGATCACCTAAGCACGTTATCGG - Intergenic
942577153 2:177375818-177375840 ACCTCTCATAACCCCCTTTTAGG + Intronic
943374250 2:187055323-187055345 AGCTCACCAAATCCCCTCTGGGG - Intergenic
944826130 2:203484921-203484943 AGCTCACCACAGGCCCTTTTTGG + Intronic
945170997 2:206995005-206995027 AGTTTTCCTAAGCTCCTTTTGGG - Intergenic
1170672012 20:18443340-18443362 TGCTCACCTGAGCTCCTTCTGGG + Exonic
1174034345 20:47658668-47658690 AGGTCACCTAAGCCTTTCTTCGG - Intronic
1176268275 20:64222041-64222063 TGCTCACGTAAGTCCCTGTTTGG + Exonic
1177015977 21:15787802-15787824 AGCTCACCTAAGCCCCTTTTTGG - Intronic
959373537 3:105559521-105559543 AGCTCTCCAAAGTCCCTTTTAGG + Intronic
959494233 3:107030696-107030718 AGCCCACCAAAGTCCCCTTTGGG + Intergenic
961911993 3:130327209-130327231 AGCAGACTTAAACCCCTTTTAGG + Intergenic
964732796 3:159885216-159885238 AGCTGACCTAAGCCAGGTTTAGG - Intronic
965611885 3:170553073-170553095 AGCTCCCCAAAGTGCCTTTTGGG + Intronic
965799339 3:172475753-172475775 ATCTCACCTAACCCCTTTTTCGG + Intergenic
966252275 3:177879396-177879418 GGCTCACCTAAGCAGCATTTAGG + Intergenic
967344278 3:188436647-188436669 ATCTCACCAAAAGCCCTTTTTGG - Intronic
967405152 3:189107228-189107250 ATCTCACTTAATCCCATTTTTGG + Intronic
969041253 4:4297814-4297836 AGCTCACCTAAGCCCTGATCTGG + Intronic
978926522 4:114252124-114252146 AGCTCACCAAAGCCCCCCTTGGG + Intergenic
984936469 4:184894183-184894205 AGAACACCAAAGCCCCTTGTAGG - Intergenic
985069585 4:186154914-186154936 AACTCCCCTTAGGCCCTTTTGGG - Intronic
990608034 5:57429727-57429749 AGCTACCCAAAGCCCCTCTTTGG - Intergenic
990823093 5:59865000-59865022 AGGTCACCTAAGACTCTTTCTGG + Intronic
992091397 5:73320635-73320657 AGCTCAGCTAAGCTTCTTCTTGG + Intergenic
993145991 5:84094746-84094768 TGCTCACTTAATTCCCTTTTGGG + Intronic
993149678 5:84144903-84144925 ATCTCACCTAAGCCAGTTTGGGG - Intronic
996273855 5:121640634-121640656 AGCCCACCAAAGCCCCTTTTGGG + Intergenic
1001124781 5:169009587-169009609 CTGTAACCTAAGCCCCTTTTAGG - Intronic
1003623090 6:7719535-7719557 AGCTCCTCCAAGCCACTTTTTGG + Intergenic
1005681879 6:28216475-28216497 TGCTCACCTGAGCACCTTTGGGG - Intergenic
1006412731 6:33884636-33884658 AGCTGCCCTAAGCCTCTCTTTGG - Intergenic
1007061429 6:38944413-38944435 AGTTCCCCCAAGCCCCTTTTTGG + Intronic
1011277736 6:85645869-85645891 AGCTCATCTCAGCCACTTTATGG + Intergenic
1011749731 6:90443016-90443038 AGGTCAGCTCAGCCCCTTTCAGG + Intergenic
1014022427 6:116606295-116606317 AGCTTGCCAAAGCCCCCTTTAGG + Intergenic
1015254588 6:131163805-131163827 AGCTCACCTAAGAAACATTTAGG - Intronic
1016471776 6:144382267-144382289 AGCTTACCTAAGCCACATATAGG - Intronic
1019059264 6:169243381-169243403 AGCTCACCTCACCCCCATGTAGG + Intronic
1019368303 7:646860-646882 AGCTCAGCTAATGGCCTTTTTGG - Intronic
1024235251 7:47392765-47392787 AGCCCTCCTCAGCCCCTCTTTGG - Intronic
1028158910 7:87464060-87464082 CCCCCACCTCAGCCCCTTTTGGG + Intronic
1028532366 7:91851876-91851898 AGCCCACCAAAGCCCCACTTAGG + Intronic
1029715848 7:102325179-102325201 AGATCACCTTAGACCCTATTGGG + Intergenic
1031837066 7:126691154-126691176 AGCTGCCCTTAGCCCCTTCTTGG + Intronic
1033420479 7:141200657-141200679 AGCTGACCTCATTCCCTTTTTGG + Intronic
1035381712 7:158445036-158445058 AGCCCAGCTCAGGCCCTTTTGGG - Intronic
1037196597 8:16198478-16198500 AGACCACCCAACCCCCTTTTGGG + Intronic
1037869182 8:22475935-22475957 AGCTAATCTAAACCCCATTTAGG - Intronic
1039573076 8:38602462-38602484 AGCTCACTCCAGCCCCTCTTGGG + Intergenic
1044570376 8:93711207-93711229 AACTCATCTAAGGCTCTTTTTGG + Intronic
1050684686 9:8154636-8154658 AGGTTTCCTAAGTCCCTTTTTGG + Intergenic
1058703469 9:107619965-107619987 AGGACACACAAGCCCCTTTTAGG - Intergenic
1060735565 9:126064619-126064641 AGCACACCAAACCCCCTTCTTGG + Intergenic
1186140563 X:6567628-6567650 AGCTCTTCTAGGCCCCTTTAGGG - Intergenic
1188593527 X:31868601-31868623 AGCTAATATAAGCCCCTTTTGGG + Intronic
1189170660 X:38906283-38906305 AACTCCCCTATGCCTCTTTTGGG + Intergenic
1190930956 X:54949472-54949494 TGCTCACCGAAGCCCCTACTTGG + Intronic
1191904280 X:66072456-66072478 AGCTCACATGGCCCCCTTTTGGG + Intergenic
1198835335 X:140798808-140798830 AGCTCTCTGAGGCCCCTTTTAGG + Intergenic
1199835155 X:151582528-151582550 AGCTCTCCTAAAGCCCCTTTGGG - Intronic