ID: 1177016025

View in Genome Browser
Species Human (GRCh38)
Location 21:15788260-15788282
Sequence CTGCATAAGGGTTCCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177016025_1177016030 9 Left 1177016025 21:15788260-15788282 CCAGGGGAGGAACCCTTATGCAG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1177016030 21:15788292-15788314 TTATAAAAAGTTTGGATTTATGG 0: 1
1: 0
2: 2
3: 47
4: 595
1177016025_1177016029 1 Left 1177016025 21:15788260-15788282 CCAGGGGAGGAACCCTTATGCAG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1177016029 21:15788284-15788306 ATTTTGCTTTATAAAAAGTTTGG 0: 1
1: 0
2: 3
3: 82
4: 819

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177016025 Original CRISPR CTGCATAAGGGTTCCTCCCC TGG (reversed) Intronic
901147515 1:7076124-7076146 ATGCATCAGGGTTCCTCTCCTGG + Intronic
902730643 1:18366541-18366563 CTGCATAAGGGTTGCAAACCTGG + Intronic
904521769 1:31101320-31101342 CTGGACTAGGGCTCCTCCCCAGG - Intergenic
904745250 1:32706783-32706805 CTGCATAGGTTTTTCTCCCCAGG - Intergenic
907313138 1:53551391-53551413 CTGCATAAGGCCTCCATCCCGGG - Intronic
911705229 1:101003537-101003559 TTGTAGAAGGGTTCCTCCCAAGG - Intronic
913028700 1:114874134-114874156 CTGCTTATGGGTTTCTGCCCTGG + Intronic
913692929 1:121296770-121296792 CTGCGGATGGGTTCCTCCCCTGG + Intronic
914144627 1:144983310-144983332 CTGCGGATGGGTTCCTCCCCTGG - Intronic
917630923 1:176890722-176890744 CTCCATAAGAGTTCCTACTCTGG + Intronic
920480252 1:206315140-206315162 CTGCGGATGGGTTCCTCCCCTGG + Intronic
924274088 1:242367598-242367620 GTGCATAGGGGTTCGTCTCCAGG - Intronic
1072035775 10:91561640-91561662 CTCCATTAGGGCTCCACCCCTGG + Intergenic
1078778118 11:14412100-14412122 CTGCAGCAGGCTTCCTCCCAAGG + Intergenic
1078793424 11:14568326-14568348 CTGCATAATGCTGCCTTCCCTGG + Intronic
1078989880 11:16635969-16635991 CTCCATGAGGGCTCCACCCCAGG - Intronic
1081343484 11:41955773-41955795 CAGCGTGAGGGTGCCTCCCCTGG - Intergenic
1093048515 12:14481129-14481151 CTGCATAACAGTTCCTCGCAAGG - Exonic
1103315115 12:120047395-120047417 TTGCATGAAGGTTCCTGCCCAGG - Intronic
1104608144 12:130204895-130204917 ATGCACAAGGGTTCCTGCCATGG + Intergenic
1105605284 13:21921487-21921509 CTGCCTAAGGCTTCCTCTCCAGG - Intergenic
1106467575 13:30026504-30026526 CTGCCTCTGGGTTTCTCCCCTGG - Intergenic
1106859779 13:33893204-33893226 CTGGCTAAGGGTTCATGCCCAGG - Intronic
1112426038 13:99302155-99302177 CTGCATCTGGGTGGCTCCCCTGG - Intronic
1112605700 13:100903961-100903983 CTTCATAAGTATTCCTCCCATGG + Intergenic
1116364093 14:44039037-44039059 TTCCATAAGGGCTCCACCCCTGG - Intergenic
1119200231 14:72746695-72746717 CTGCAGATGGGGTCCTTCCCCGG + Intronic
1119931769 14:78554352-78554374 CAGCAGAAGGGTTCCACCCCAGG - Intronic
1124368670 15:29091096-29091118 GTGGACAGGGGTTCCTCCCCTGG + Intronic
1129024776 15:72560592-72560614 GTGCATAAGGCTGCCTCCCTTGG - Intronic
1129741010 15:77989677-77989699 CTGCATCAGGGCTCCATCCCGGG + Intronic
1130257118 15:82330991-82331013 CTGCATCAGGGCTCCATCCCGGG + Intergenic
1130597834 15:85258999-85259021 CTGCATCAGGGCTCCATCCCGGG - Intergenic
1136989601 16:35143960-35143982 CTGCCTGAGGTTTCCTCACCTGG - Intergenic
1138235421 16:55378094-55378116 CTGCTTAAGGGTTCTTCTCTTGG + Intergenic
1140519571 16:75569464-75569486 ATGCCCAAGGCTTCCTCCCCTGG - Intronic
1141849647 16:86636617-86636639 CTGCATACTGGCTCCTGCCCAGG + Intergenic
1144020371 17:11235636-11235658 CTGCAGAAAGTTGCCTCCCCTGG - Intergenic
1144627574 17:16852160-16852182 CTGCATAAGGGTCTCTCTCCTGG - Intergenic
1144878866 17:18420562-18420584 CTGCATAAGGGTCTCTCTCCTGG + Intergenic
1145153369 17:20523832-20523854 CTGCATAAGGGTCTCTCTCCTGG - Intergenic
1146527690 17:33580870-33580892 CTGCATAGGGGCACCTACCCAGG + Intronic
1147581775 17:41631119-41631141 CTGCATAAGGGTCTCTCTCCTGG - Intergenic
1152526251 17:80889842-80889864 CTGCATACGGGGGCCTCCCTCGG - Intronic
1155340320 18:24807330-24807352 CTTCATAAGTGTTTCTCCCACGG - Intergenic
1155855885 18:30833887-30833909 TTTCAAGAGGGTTCCTCCCCTGG - Intergenic
1157428193 18:47601977-47601999 GTGCATAATGGGTCCTCCCAGGG - Intergenic
1160859947 19:1233538-1233560 CTGCAGAACGGTACCTGCCCCGG + Exonic
1161021473 19:2013533-2013555 CTGCAGAAGGTTGTCTCCCCTGG - Intronic
1165665118 19:37621645-37621667 CTGCATTAGGGAGCCTCTCCAGG - Intronic
934126972 2:88904364-88904386 CTGCATAAGGGATCCTTCAGGGG - Intergenic
934978739 2:98823269-98823291 CGGCTTGAGGGGTCCTCCCCGGG + Exonic
935290809 2:101609571-101609593 CTTCATAAAGGTTCCTCTCCAGG - Intergenic
941165177 2:162076049-162076071 CTGCATCAGAGTCCCTCCCAGGG - Intergenic
941982998 2:171480347-171480369 CTTCTTAAGCCTTCCTCCCCTGG + Intronic
943320350 2:186436407-186436429 CTGGAGGAGGGTTCCTTCCCTGG - Intergenic
1173277511 20:41597542-41597564 CTAGATAAGGGGTCCTTCCCAGG - Intronic
1175407559 20:58744883-58744905 CTGCATGAGTGTTCCTCCCAAGG + Intergenic
1177016025 21:15788260-15788282 CTGCATAAGGGTTCCTCCCCTGG - Intronic
1177577417 21:22976191-22976213 CTTCATGAGGGGTCCACCCCTGG + Intergenic
1182855437 22:33513167-33513189 CTGCAAAAGGGCTTCTCCCGCGG - Intronic
961713813 3:128845828-128845850 CTGCAGCAGGGCTCCTCCCGAGG - Intergenic
965026787 3:163312135-163312157 CTGCATAAAGATGCTTCCCCAGG - Intergenic
965672867 3:171164984-171165006 CTGCATAAGAATTCTTCCCTGGG + Intronic
966140070 3:176747240-176747262 CTGCATCAGGGCTCCAACCCTGG - Intergenic
966233465 3:177674360-177674382 CTGCATGAGGCTTCCTGGCCAGG + Intergenic
967269681 3:187722724-187722746 ATGCATATGGGTTCTTCACCTGG - Intronic
970399662 4:15705061-15705083 CTGCAAAAGGCTTCCACCTCTGG - Intronic
971024211 4:22571878-22571900 CTGCATGAGGGAGCCTCCCTAGG + Intergenic
971453981 4:26826751-26826773 CTTCATGAGGGTTACTGCCCCGG + Intergenic
971607699 4:28679671-28679693 CTGCATAAGGATATCTCCCTAGG + Intergenic
980458299 4:133073346-133073368 CTCCATGATGATTCCTCCCCAGG - Intergenic
982341237 4:154301215-154301237 CTGCATAAGGATATCTTCCCAGG - Intronic
984317072 4:178141434-178141456 CTGGAGAAGGGTTCCTTCCCTGG - Intergenic
988912702 5:35860830-35860852 CTGCATGTTTGTTCCTCCCCAGG + Exonic
991130549 5:63117836-63117858 CTGGATAAGAGATACTCCCCTGG - Intergenic
992325027 5:75651987-75652009 ATTCATAAGGGTTCCACCCAGGG + Intronic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
996449953 5:123609770-123609792 CTCCATTAGGCTTCCTTCCCAGG - Intronic
997522114 5:134529648-134529670 CTGCATCGGGGACCCTCCCCAGG - Intronic
997691574 5:135830999-135831021 CTGCATGAGGAGGCCTCCCCAGG - Intergenic
1000410794 5:160933865-160933887 CTGGAGAAGGGTTCCTTCCCTGG + Intergenic
1007284192 6:40736089-40736111 CTGCATAAGGGCTGCTCCAGTGG - Intergenic
1011555757 6:88570123-88570145 CTCCATGAGGGCTCCACCCCTGG + Intergenic
1011823090 6:91275279-91275301 CTGGATTATGGTTCCTCTCCAGG + Intergenic
1014787697 6:125637315-125637337 CTACATAATGGTTACTTCCCTGG - Intergenic
1018134395 6:160765633-160765655 CTTGATAAGGGTCCCTCCCTAGG - Intergenic
1024635986 7:51290849-51290871 CTGAAGCAGGGTGCCTCCCCAGG + Intronic
1027869181 7:83684999-83685021 CTGCCCGAGGGTTCCTCCACAGG - Intergenic
1030071942 7:105705544-105705566 CTGCAGAAGGATCCGTCCCCAGG + Intronic
1045405442 8:101862026-101862048 CTGCAAAAGGATTCATCACCAGG + Intronic
1058523820 9:105837803-105837825 CTGCACAAGGTTTGCTCCCAGGG + Intergenic
1058794350 9:108483579-108483601 CAGCATCAGGGTTTCTCCACAGG - Intergenic
1059539718 9:115118324-115118346 ATGCAAATGGGTTCCTTCCCTGG - Intergenic
1062550449 9:137083705-137083727 CTGCCCCAGGGTTCTTCCCCTGG + Exonic
1193143518 X:78054334-78054356 CTCCATGAGGGTTCCACCCCTGG + Intergenic
1194306784 X:92257953-92257975 CTCCATGAGGGCTCCACCCCTGG + Intronic