ID: 1177016624

View in Genome Browser
Species Human (GRCh38)
Location 21:15797569-15797591
Sequence TTCCTTTGGTGTGGGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 7, 3: 40, 4: 330}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177016624_1177016628 -7 Left 1177016624 21:15797569-15797591 CCAGCACACCCACACCAAAGGAA 0: 1
1: 0
2: 7
3: 40
4: 330
Right 1177016628 21:15797585-15797607 AAAGGAAGTTCTAAGTATCCAGG 0: 1
1: 0
2: 1
3: 8
4: 190
1177016624_1177016631 21 Left 1177016624 21:15797569-15797591 CCAGCACACCCACACCAAAGGAA 0: 1
1: 0
2: 7
3: 40
4: 330
Right 1177016631 21:15797613-15797635 GGAAAATTCTCTATCTACAATGG 0: 1
1: 0
2: 0
3: 13
4: 210
1177016624_1177016632 22 Left 1177016624 21:15797569-15797591 CCAGCACACCCACACCAAAGGAA 0: 1
1: 0
2: 7
3: 40
4: 330
Right 1177016632 21:15797614-15797636 GAAAATTCTCTATCTACAATGGG 0: 1
1: 0
2: 0
3: 16
4: 287
1177016624_1177016629 0 Left 1177016624 21:15797569-15797591 CCAGCACACCCACACCAAAGGAA 0: 1
1: 0
2: 7
3: 40
4: 330
Right 1177016629 21:15797592-15797614 GTTCTAAGTATCCAGGAACAAGG 0: 1
1: 0
2: 1
3: 11
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177016624 Original CRISPR TTCCTTTGGTGTGGGTGTGC TGG (reversed) Intronic
900179839 1:1306253-1306275 TTCCAGTCGTGTGGGGGTGCTGG - Intronic
900752779 1:4409279-4409301 TGCCTTAGGTGGGGGTGGGCAGG - Intergenic
901171234 1:7259117-7259139 TTCCTTCTGTGCGGGTGTGTGGG + Intronic
901192837 1:7422723-7422745 TGCCTATGGAGTGGGTGTGAGGG - Intronic
903081134 1:20814251-20814273 TTCATCTGGTCTGGGTGTGATGG - Intronic
904456164 1:30649492-30649514 ATCCTGTGGAGTGGTTGTGCTGG - Intergenic
906365253 1:45205138-45205160 TTCCTTGGGTGGGGGTGTGGAGG + Intronic
906431215 1:45757160-45757182 TTCTTTTGGTGTTGGTGTTGTGG + Intergenic
906561288 1:46759123-46759145 TTTCTTTGGTGAGGGTCTGTTGG + Intronic
907787865 1:57631110-57631132 TTTCTTTGGTGGGGGTGGGCAGG + Intronic
907867475 1:58412134-58412156 TTCCTTTGGTGTTGCTCAGCTGG + Intronic
908643468 1:66250817-66250839 TTCCTTTCCTGTGGCTTTGCAGG - Intronic
908781761 1:67697397-67697419 TTTTTTTGGTGGGGGTGTGGTGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
910714206 1:90212986-90213008 TTCTTATGGTGTTGGTGTGCTGG + Intergenic
910736911 1:90468966-90468988 TTCCTTTGTAGTGGGCTTGCTGG - Intergenic
910793589 1:91075658-91075680 TTCTTGTGGTGTGAGTGAGCAGG - Intergenic
910834714 1:91497132-91497154 TTTTTTTGGTGTGTGTGTGGGGG + Intergenic
913401945 1:118445733-118445755 TTCCTTTAGGGTAGGTATGCTGG - Intergenic
913694965 1:121315914-121315936 CTCTTTTTGTGTGGGGGTGCAGG - Intronic
913706915 1:121434525-121434547 TCCCTCTGCTGTGGCTGTGCTGG - Intergenic
914142596 1:144964144-144964166 CTCTTTTTGTGTGGGGGTGCAGG + Intronic
914788237 1:150852888-150852910 TTCCATTTGGGTGGGTGTTCCGG - Intronic
914882481 1:151558138-151558160 TTCTTTTAGTGTAGGTCTGCTGG + Intronic
914901131 1:151711733-151711755 TTCTTTTGGCGTGGGTGTAGGGG - Intronic
915101994 1:153507392-153507414 TTCCTTGGGTGTGTGTGTGGGGG - Intergenic
915214386 1:154330106-154330128 TTCCTCTGGAGTGGGGGTGGGGG + Intronic
919167123 1:193909663-193909685 TTCTTTTGGTCAGGGAGTGCTGG - Intergenic
919179804 1:194065959-194065981 TTCCATTGGTGTGGATCTGTTGG + Intergenic
919770523 1:201155324-201155346 TTCCTTAGGGGTGGGTGGGAGGG + Intronic
919810496 1:201406026-201406048 CCCCTTTGGTGCGGGTGTGTGGG + Exonic
920482297 1:206334297-206334319 CTCTTTTTGTGTGGGGGTGCAGG - Intronic
921265013 1:213414954-213414976 ATTCTTTGGGGTGGGTGTGGAGG + Intergenic
922692019 1:227700515-227700537 TCCCTTTGCTGTAGGTCTGCTGG - Intergenic
922793786 1:228327151-228327173 TTCTTATAGTGTGGGTATGCTGG + Intronic
924083056 1:240419768-240419790 TTCCTTTGGTCAGGGGGTCCTGG + Intronic
1062820571 10:531630-531652 GCCCTATGGTGTGGGTTTGCCGG - Intronic
1063071130 10:2665431-2665453 TTCTTTTGGAGTAGGTCTGCTGG - Intergenic
1063733862 10:8730225-8730247 TTCCTTTGGTGGGGGGGGGGGGG - Intergenic
1065178173 10:23098613-23098635 GTCCTTTTCTGTGTGTGTGCAGG - Intronic
1068335607 10:55629899-55629921 TTCACTTGGTGTGTGTGCGCTGG + Intergenic
1068635703 10:59345805-59345827 TTGATTAGGTGTGGGTTTGCTGG - Intronic
1069981103 10:72253231-72253253 AACATTTGCTGTGGGTGTGCTGG - Intergenic
1070703254 10:78618693-78618715 TTCCTTTTGTGTGGGTGGCAAGG + Intergenic
1070836077 10:79447615-79447637 TTCTTTTGGTGTGGGGGCGGGGG - Intergenic
1071615964 10:87076955-87076977 TACCTTTGGTTTGGGTGACCTGG + Intronic
1072615314 10:97045609-97045631 TTCCTTAAATGTGGGTGTGGGGG - Intronic
1072856244 10:98950297-98950319 ATCCTTGTGTGTGGGTGGGCTGG - Intronic
1073135805 10:101219403-101219425 TTCCTCTGGTGTTGGAGGGCCGG - Intergenic
1074879534 10:117644547-117644569 TTCTTCTGGTGTAGGTTTGCTGG + Intergenic
1075092775 10:119452827-119452849 TTGCTTTGGTCTGGGTGGGAGGG + Intronic
1076262749 10:129080909-129080931 TTCTTTTGGTGTGAGTCTACTGG - Intergenic
1077511805 11:2969443-2969465 TTCCTGTGGTGTGAGTGTGCAGG - Intronic
1077798537 11:5516051-5516073 TTCCTTTGGTGTTTCTGTCCCGG + Exonic
1077907971 11:6548351-6548373 TTCCTTTGATGTGGCTGCTCAGG - Exonic
1082875370 11:57982713-57982735 TTGCTTTGGTGTGCGAGTCCCGG + Intergenic
1083883397 11:65559005-65559027 TTCCTTTCGTCTGGCCGTGCTGG + Intergenic
1084965050 11:72740084-72740106 TTCCCTTGGTGTGGGGCTCCTGG - Intronic
1085103552 11:73822284-73822306 TGCCTTTGGGGTGGGGGTGCAGG - Intronic
1085399297 11:76225994-76226016 GGCCTTTGGGCTGGGTGTGCAGG - Intergenic
1086888172 11:92226511-92226533 CTCCCGGGGTGTGGGTGTGCTGG + Intergenic
1088496856 11:110440020-110440042 TTCCTTTGGTCTGTGTGTCTAGG + Intronic
1089291317 11:117439371-117439393 TGCCATTGGTGTGGATGAGCCGG + Exonic
1089957705 11:122587294-122587316 TTCTTTTAGTGTGGGTCTGCTGG + Intergenic
1090603926 11:128401812-128401834 TTTTTTTGGTGGGGGCGTGCGGG - Intergenic
1090865818 11:130699576-130699598 TCCCTTTGTTGTGGGTCTGATGG + Intronic
1091630356 12:2155223-2155245 TTCCCTTGGTGTGGGATTGATGG + Intronic
1092164218 12:6333185-6333207 GTCCTGTGGGGTGGGGGTGCAGG - Intronic
1092225859 12:6748084-6748106 TTCTTTTGATGTGTGTGGGCAGG + Exonic
1094697350 12:32833369-32833391 TTTTTTTGGTGTGTATGTGCTGG + Intronic
1095391686 12:41714659-41714681 TTGCTTTGGTGTCAGTGTGCAGG + Intergenic
1095447030 12:42292862-42292884 TTCCTTTAATTTGGGTCTGCCGG - Intronic
1096194799 12:49642938-49642960 GGCCTTTGGTGTGGAGGTGCTGG - Exonic
1097466241 12:59928390-59928412 TTATTTTGGTGTGGTTGAGCTGG - Intergenic
1097722412 12:63037391-63037413 TTCCTTTGGTTAGGGTGATCAGG - Intergenic
1097909827 12:64957967-64957989 TTCTGTGGGTGTGGGGGTGCAGG - Intergenic
1098384706 12:69906724-69906746 TTCCTTTGCTCAGGGTGAGCAGG + Intronic
1099626370 12:85079995-85080017 TTCCTTTATTGTAGGTCTGCTGG + Intronic
1100669736 12:96798280-96798302 TTCCTTTGGTGAGGATCTTCTGG + Intronic
1101490845 12:105208119-105208141 TTCCTGGTGTGTGGGTGTGTGGG - Intronic
1101652471 12:106690058-106690080 TTCCTTTGGTGTGTGTGTTGTGG + Intronic
1101939222 12:109087310-109087332 TTCCTCTGCTGGGGGTGAGCTGG + Exonic
1102397898 12:112602992-112603014 TTCCTGTGATGAGGGTGTGATGG + Intronic
1102512869 12:113427730-113427752 TTCCATAAGTGTGGCTGTGCTGG - Intronic
1103345892 12:120250055-120250077 CTCCTCTGGGGTGGGTGTGGAGG - Intronic
1103637150 12:122316493-122316515 TGACTTTGGGGTGGGTGTGGTGG - Intronic
1104204357 12:126622976-126622998 TTCCCATGGGGTAGGTGTGCAGG - Intergenic
1104509678 12:129365947-129365969 CTCGGTAGGTGTGGGTGTGCGGG - Intronic
1105990967 13:25620431-25620453 TTCCTTTAGTATGGGTTGGCTGG - Intronic
1106102358 13:26706148-26706170 TTTCTTTAGTGAGGATGTGCTGG + Intergenic
1106249695 13:27974117-27974139 TTCCTTTGGGGTGGAAGTTCTGG - Intergenic
1108270649 13:48756258-48756280 TTCCATTCCTGTGGGTTTGCAGG - Intergenic
1112106543 13:96246650-96246672 TTCCTTTTTTGTGTGTGTGGAGG + Intronic
1112538049 13:100280507-100280529 TGTGTGTGGTGTGGGTGTGCAGG - Intronic
1113801036 13:113086336-113086358 TCGCTTTGGTGTGAATGTGCAGG + Intronic
1114181102 14:20368736-20368758 TCCCTTTGGGATAGGTGTGCAGG + Intronic
1114377088 14:22158661-22158683 TTACTTTGATGTGTGTGTGTGGG + Intergenic
1114743216 14:25119394-25119416 TTCCTTTGATCTGGGTGGGTGGG + Intergenic
1115190038 14:30738269-30738291 TTCCTTTGGTGAGATTCTGCTGG - Intergenic
1115282808 14:31683768-31683790 TTTCTATGTTGTGGGTCTGCTGG + Intronic
1115548983 14:34488231-34488253 TTCCTTTGGTGGAGTTGTGGAGG - Intergenic
1117031747 14:51678828-51678850 TTCTTTTGGAGTGGGTGGGTGGG + Intronic
1117558203 14:56908234-56908256 TTCCTTAGGGGTGGATGTGTTGG + Intergenic
1117994209 14:61463270-61463292 TTCCTTTGGTGTGAGGATGGAGG - Intronic
1118945587 14:70383757-70383779 TTCATTTTGTGTGTGTATGCTGG - Intronic
1119411243 14:74432094-74432116 GTCCTTGGGAGTGGGTGTTCTGG - Intergenic
1119693217 14:76692863-76692885 TTCTTTTTGTGTGTGTGTGATGG + Intergenic
1121533412 14:94674145-94674167 CTCCTCTGGTGGGGGTGGGCCGG - Intergenic
1122724181 14:103739733-103739755 TTCCCTTGGTCAGGCTGTGCTGG - Intronic
1123460715 15:20467726-20467748 TTCTTTTGGTGTGGGTCTTCTGG - Intergenic
1123657346 15:22532690-22532712 TTCTTTTGGTGTGGGTCTTCTGG + Intergenic
1124095192 15:26642662-26642684 CTGCTTTGGTGTGTGTGTGCGGG - Intronic
1124147083 15:27137818-27137840 TTCCTTTGGTGGTGGTGGGTGGG + Intronic
1124271352 15:28283521-28283543 TTCTTTTGGTGTGGGTCTTCTGG - Intronic
1124311257 15:28627899-28627921 TTCTTTTGGTGTGGGTCTTCTGG + Intergenic
1125489612 15:40136832-40136854 TTCTCTTGGTGTGTGTGTGGTGG - Intergenic
1127140335 15:55969566-55969588 TTATTTTATTGTGGGTGTGCTGG - Intronic
1128065808 15:64763790-64763812 TTCCAATGGTGTGTGTGTGTAGG + Intronic
1128947103 15:71832666-71832688 TTCCTTTAGTGCAGGTCTGCTGG - Intronic
1129459135 15:75691294-75691316 TTCCTTTGGTGAGTGTTTGGAGG - Intronic
1130272800 15:82461119-82461141 TTCCTTTGGTGAGTGTTTGGAGG + Intergenic
1130465150 15:84188472-84188494 TTCCTTTGGTGAGTGTTTGGAGG + Intergenic
1130487538 15:84406330-84406352 TTCCTTTGGTGAGTGTTTGGAGG - Intergenic
1130499115 15:84485064-84485086 TTCCTTTGGTGAGTGTTTGGAGG - Intergenic
1130587441 15:85193085-85193107 TTCCTTTGGTGAGTGTTTGGAGG + Intergenic
1130969247 15:88719104-88719126 TTTCTTTGGGGTGGGTGAGGTGG + Intergenic
1133284903 16:4686182-4686204 TGCCCTTGCTGTGGCTGTGCTGG + Intronic
1133554973 16:6897396-6897418 TTCCTTTTGTGTGTGTGTGACGG - Intronic
1134027979 16:10968917-10968939 TTTATTTGGTGTGGGAGGGCGGG + Intronic
1135423534 16:22320726-22320748 TTCCTTTAATGTGGGTCTGTTGG + Intronic
1140960759 16:79910350-79910372 TTCTTTTGCTGTGGGTGTCATGG - Intergenic
1141197596 16:81872423-81872445 TTGATTTTGTGTGTGTGTGCTGG + Intronic
1141424311 16:83935467-83935489 TTGTTCTGGTGTGGGTGTCCCGG + Intronic
1142065480 16:88059935-88059957 CTCCTGGGGTGTGTGTGTGCAGG - Intronic
1143565921 17:7720508-7720530 TTCCTTTCCTGTGGGTGAGCCGG + Intronic
1145859345 17:28194617-28194639 CTCCTCTGGTGTGGGAGTGATGG + Exonic
1150299381 17:64035921-64035943 TTCCTTTGTTGTGGGTTTGTGGG + Intergenic
1150577579 17:66443780-66443802 TTCATTAGGTGTGGGTGGTCAGG - Intronic
1151373855 17:73669377-73669399 TTCCTTTTGTGTGAGTATGGTGG + Intergenic
1152380094 17:79937820-79937842 CACCTTTGATGTGGGCGTGCTGG - Exonic
1153277316 18:3380234-3380256 TTTCTTTTGTGTGTGTGTGGTGG - Intergenic
1153769572 18:8404669-8404691 TTCCTTGGTTGTGGCTGTGATGG + Intronic
1154095365 18:11409847-11409869 TTCCTCTTGTGTGTGTGTGGGGG + Intergenic
1154932298 18:21012303-21012325 TTCCTTTAGGGAAGGTGTGCTGG + Intronic
1154984515 18:21536300-21536322 TTCTTTTGGGCTGGGTGTGGTGG + Intronic
1156564976 18:38177145-38177167 CTCCTTTTGTGTGTGTGTGTTGG + Intergenic
1156640234 18:39086264-39086286 ATCCTCTGTTGTGGGTGTGGAGG + Intergenic
1156739599 18:40308044-40308066 TACCTTTGCTGTGGTTGTGAAGG + Intergenic
1158260851 18:55604392-55604414 TTCCTCTGGTGGGGGTGAGATGG + Intronic
1158364913 18:56723383-56723405 TTCTTTTAGTGTAGGTCTGCAGG + Intronic
1158537622 18:58322601-58322623 TTGCTGTGGTGTGGGTGGGTGGG + Intronic
1159023312 18:63160798-63160820 TTCCTTTGGGGTGGGGGTAAGGG + Intronic
1160986379 19:1840872-1840894 GTCCTGTGGTGTGTGTGTCCAGG + Intronic
1161089399 19:2352584-2352606 GACCTTTGGGGTGGGGGTGCTGG - Intronic
1162662263 19:12179596-12179618 TTCTTTTGGGCTGGGTGTGGTGG - Intronic
1164026999 19:21361425-21361447 TACCATTGGTCTGGGTGTGGTGG - Intronic
1165698300 19:37918048-37918070 TTACATTGGTGTCGGTGTGCTGG + Intronic
1166302489 19:41919818-41919840 TTCACATGGTGTGGCTGTGCAGG - Intronic
1166408597 19:42541258-42541280 TTCCAGTGGTGTGGGGGTGAGGG + Intronic
1166491622 19:43265705-43265727 TTTTTTTTGTGTGTGTGTGCAGG + Intronic
1167289355 19:48615872-48615894 CTCACTTGGTGTGGCTGTGCGGG + Exonic
925504933 2:4551893-4551915 TGCCCTTGGTGTGGGATTGCAGG - Intergenic
927418844 2:22908270-22908292 GCCCTTTGGTGTGGCTGTGAGGG - Intergenic
927849573 2:26490468-26490490 TTCCCCTGGCCTGGGTGTGCAGG + Intronic
927931646 2:27049635-27049657 GTCCTGTGGGGTGGGTGTGCCGG - Intronic
928124129 2:28604345-28604367 TGCCTTTGGAGTGGGAGTGGGGG - Intronic
928456755 2:31429257-31429279 TTCCCTAGGTGTGGTTGTGTGGG - Intergenic
928527154 2:32152722-32152744 TTTCTTTGGTGGGGGGTTGCTGG + Intronic
931674395 2:64679551-64679573 TTACTGTGGTGTGGGTGTTGGGG + Intronic
932168254 2:69528355-69528377 ATCTTTTGGTGAGGGTGTGCTGG + Intronic
933099553 2:78235955-78235977 TTCCTTTAGTGTGGGTCTGCTGG + Intergenic
933803901 2:85984203-85984225 TTCCTTGTGTTTGGCTGTGCTGG - Intergenic
935961372 2:108429038-108429060 CTCCCTTAGTTTGGGTGTGCAGG - Intergenic
936251681 2:110872783-110872805 ATCCTTTGGTGTGTGAGTGCTGG + Intronic
937342037 2:121097250-121097272 TTCCTTGGCTCTGGCTGTGCCGG - Intergenic
938028563 2:127971999-127972021 TTACTTGGGTGTGGGAGTGTGGG + Intronic
940461427 2:153967934-153967956 TTACTTTGCTGTGAGTGAGCTGG + Intronic
940765332 2:157784179-157784201 TTTATTTGGTGTGGGAGTGGGGG + Intronic
941437715 2:165492073-165492095 TTCCTTTGGGGTGGGAGTTGGGG - Intronic
941778281 2:169416495-169416517 TGCCTTTTTTGTGGCTGTGCAGG - Intergenic
944497101 2:200317918-200317940 TTCCTTAGCTGTGGGTGTTTGGG + Intronic
945104108 2:206292007-206292029 TTCCTTTAGTGAGAGTCTGCTGG - Intronic
945868912 2:215205777-215205799 TACCTTTTGTGTGTGTGTGTTGG - Intergenic
945943798 2:215974899-215974921 TTGATTTACTGTGGGTGTGCTGG - Intronic
946411224 2:219516166-219516188 CTCTCTGGGTGTGGGTGTGCAGG - Intronic
947768666 2:232653866-232653888 TTCCTTTGGAGAGAATGTGCTGG - Intronic
947861706 2:233364284-233364306 TTCCTTTAGTGTGGGTCTGCTGG - Intronic
948001354 2:234570402-234570424 TTCCTGTGGTTTGGGTGGGCTGG - Intergenic
948376777 2:237525920-237525942 TTCCTTTGGCGTGATTGTCCGGG + Intronic
948534759 2:238637606-238637628 TTCCTTTGGGCTAGGAGTGCAGG - Intergenic
1169964624 20:11202258-11202280 TTCTTTTAGTGTAGGTTTGCTGG - Intergenic
1170834898 20:19875768-19875790 GTCCTTTGGTGTGGGCCTGCAGG + Intergenic
1172190413 20:33058979-33059001 TTGCATTTGTGTGAGTGTGCAGG + Intronic
1173559977 20:43996649-43996671 TTGCTTGGGTGTGTGTGTGTGGG + Intronic
1174005907 20:47410526-47410548 TTCCATTGGTGTTGCTGTGCTGG + Intergenic
1175813428 20:61871170-61871192 TTCCTCTAGTGTGGGTCTCCAGG + Intronic
1176128400 20:63486115-63486137 TCCCTTTTGTGTGGGTTTGAGGG + Intergenic
1176375302 21:6084058-6084080 TTCATTTTGGGTGGGAGTGCTGG - Intergenic
1177016624 21:15797569-15797591 TTCCTTTGGTGTGGGTGTGCTGG - Intronic
1178289446 21:31354465-31354487 TTCGTGTGGTGGGGGTGTGGAGG - Intronic
1179267563 21:39818050-39818072 TTCCTTTGGGGAGGGTGGGCTGG + Intergenic
1179748172 21:43454186-43454208 TTCATTTTGGGTGGGAGTGCTGG + Intergenic
1179814865 21:43899133-43899155 TTCCTCTGGTTAGAGTGTGCTGG + Intronic
1181044789 22:20209433-20209455 TTCTTTTGGAGGGGGTGTGTTGG - Intergenic
1182144240 22:27987377-27987399 TCCCTTTGGTGTGGGGGTGGTGG - Intronic
1182273843 22:29172268-29172290 TTCCTATGGTTTGGGTGGGGAGG + Intergenic
1183158986 22:36098139-36098161 TTCCCTTTGTGTGTGTGTGTGGG + Intergenic
1183180521 22:36257095-36257117 TTTCCTTGGTGTGGGAGTGAGGG + Exonic
1183813242 22:40275975-40275997 TTTTTTTGGTGTGTGTGTGGGGG - Intronic
949314641 3:2738447-2738469 TTCCTTTAGTGAGGGTCTGCTGG - Intronic
949681904 3:6523658-6523680 TTCCTGGGGTGTGGGTTTCCTGG + Intergenic
949928595 3:9060783-9060805 TTCCATAGGTGTGGCTGTGCAGG - Intronic
950501219 3:13365161-13365183 TTCCTCTGGGGTGGGTGTGAAGG - Intronic
950764162 3:15260985-15261007 TTCCTTTGGTGTGAATATGGTGG - Intronic
951359925 3:21713179-21713201 TTCCTTTGAGGTTGGTGAGCAGG - Intronic
953130013 3:40128706-40128728 TTGCTTTGGTTTGTGTATGCAGG - Intronic
954538652 3:51379691-51379713 TTCCTGTGGTGGGGGTGTTTTGG - Intronic
954817436 3:53293931-53293953 TGCCTTGTGTGTGTGTGTGCGGG - Intronic
955226516 3:57064593-57064615 TTCCTTTGGGCTGGGTATGGTGG - Intronic
957226099 3:77448926-77448948 TTCATTTGGTGTGATTGTGTTGG + Intronic
957264683 3:77947876-77947898 TTCCTTTGTTGTAGTTGTGGGGG + Intergenic
959888449 3:111528164-111528186 TTCCTATGTTCTGGGTGTTCTGG - Intronic
960781439 3:121322661-121322683 TTCTTTTTGTGTGTGTGTGTGGG + Intronic
961320572 3:126070711-126070733 TTCCTTTAGGGCAGGTGTGCTGG - Intronic
961767456 3:129222577-129222599 AACCTTTTGTGTGTGTGTGCTGG + Intergenic
961776983 3:129294788-129294810 TTCTTGTAGTGTGGGTCTGCTGG + Intronic
962621103 3:137180225-137180247 TTTTTTTGGTGAGGGTATGCTGG + Intergenic
962829377 3:139126571-139126593 TTCCTTTTTTGTGTGTGTGATGG + Intronic
963829341 3:149990352-149990374 TTACTATGGTGTGGCTGTGGGGG - Intronic
964659979 3:159109645-159109667 TTTCTTTGGTGTGGGTGTGTGGG + Intronic
965321198 3:167253248-167253270 TTCATTTGGTGTCTGTGTGTTGG - Intronic
965982528 3:174710987-174711009 TTTCTTTGATGTGGCTGTGTTGG - Intronic
967771968 3:193344047-193344069 TTGCTTTGGTGTAGGTTTGGAGG - Exonic
968128677 3:196178930-196178952 TTCCTTCGGGCTGGGTGTGTTGG - Intergenic
968342708 3:197970936-197970958 TTCCTGTAGTGTAGGTCTGCTGG + Intronic
969006400 4:4023665-4023687 TTCTTTCGGTGGGGGTGGGCTGG + Intergenic
969149634 4:5158359-5158381 GTCCTTCAGTGTGGGTGAGCAGG + Intronic
969806551 4:9613626-9613648 TTCTTTCGGTGGGGGTGGGCTGG - Intergenic
970953333 4:21781550-21781572 TTCTTTTGGTCTAGGTCTGCTGG - Intronic
971498421 4:27292482-27292504 GTCCTTTTGTGAGGGTCTGCAGG + Intergenic
971988803 4:33864811-33864833 TTCCTCTGCTGTAGGTCTGCTGG - Intergenic
972713748 4:41624901-41624923 TTCTTTAGGTGAGGCTGTGCAGG + Intronic
975261373 4:72303515-72303537 TTCTTGTGGTGTGGGTGTATTGG - Intronic
975384256 4:73737246-73737268 TTCCTATGGCGTGGGTGGGAGGG + Intergenic
975873235 4:78805681-78805703 TTCCTTTAGGCTGGGTGTGGTGG + Intronic
976331169 4:83832640-83832662 TTCCTTTTTTGGGGGTGTGAGGG + Intergenic
976455831 4:85246185-85246207 TCCCTAGGGCGTGGGTGTGCAGG + Intergenic
976689667 4:87855605-87855627 TTCCTTTGGCTAGAGTGTGCAGG - Intergenic
977135615 4:93300113-93300135 TTCCTTTTGTGTGTGTGTGATGG + Intronic
979066957 4:116149813-116149835 ATCCTTTGTGGTGGGTGTGGTGG + Intergenic
979371848 4:119898037-119898059 TTCCTTTGCTGTATCTGTGCAGG + Intergenic
979550011 4:121979938-121979960 TTCCTTTAGTGGGGCTGTGCAGG - Intergenic
983253065 4:165366428-165366450 TTCCTTTGGAGGGGGCGTGGTGG + Intronic
984192287 4:176620105-176620127 TTCCATTGGTTTGGGGGTGTAGG + Intergenic
984655748 4:182316586-182316608 TTCCTTTTTTGTGGGAGTGGGGG - Intronic
985002886 4:185503292-185503314 TTCCTTTGGGGTGGGTGGATTGG + Intronic
985717342 5:1470017-1470039 TTGCTATGGAGAGGGTGTGCTGG + Intronic
986657931 5:10033682-10033704 CTCCTTTGGTGTGTGTGTCCTGG - Intergenic
989459468 5:41680923-41680945 TTCCTTTTGTGAGGATCTGCTGG - Intergenic
991019123 5:61961811-61961833 TTCTTTTGGTGAGGGTGAGTTGG - Intergenic
991182272 5:63766447-63766469 TTCCTTGGGTCTAGGTGTGGTGG - Intergenic
992284625 5:75221349-75221371 TTCTTTGTGTGTGTGTGTGCAGG + Intronic
993923206 5:93832544-93832566 TTCCTTAGCTGTGGGAGTGCTGG + Intronic
995285278 5:110381435-110381457 TTCCCTTGGTGTCAGTGTTCTGG + Intronic
995380937 5:111532541-111532563 TTCTTGTTGTCTGGGTGTGCAGG - Intergenic
995947542 5:117667270-117667292 TTCCTTTGGAGCGTGTTTGCAGG + Intergenic
998568201 5:143234587-143234609 TTCCATGGGTTTGGGTGAGCTGG + Intergenic
999128573 5:149265266-149265288 TTCCTTTGCTGTCTGTGTGAGGG + Intergenic
999691824 5:154153235-154153257 TTCCTTTAGTGTAGGTCTGCTGG - Intronic
1001654444 5:173338726-173338748 TGGCTTTGGTGTGGGTGGGAAGG + Intergenic
1001821491 5:174713795-174713817 TTCCTTAAGTATGTGTGTGCTGG - Intergenic
1001976061 5:175999821-175999843 TTCTTTTAGTGCGGGTCTGCTGG - Intronic
1002067379 5:176658682-176658704 TTGCTCTGGTGTGGGAATGCAGG + Exonic
1002241362 5:177843950-177843972 TTCTTTTAGTGCGGGTCTGCTGG + Intergenic
1002584986 5:180239363-180239385 ATCCTGGGGTGTGGGAGTGCCGG - Intronic
1003208934 6:4041741-4041763 TTCTTTTTGTGTGTGTGTGTGGG - Intronic
1003210565 6:4061007-4061029 TTTCCTAGGTGTGTGTGTGCAGG + Exonic
1003244183 6:4370275-4370297 TTTCTTTGGTTTGGGAGTCCAGG + Intergenic
1003693647 6:8379943-8379965 ATCATTTGGTGAGGGTGTGGAGG + Intergenic
1004080382 6:12386746-12386768 TTCCTTGTGTGTGTGTGTGGGGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1005654346 6:27918266-27918288 TTCCCTTGGGCTGGGTGTGGTGG - Intergenic
1006175300 6:32117734-32117756 CTTCTTTGTTGTGGGAGTGCTGG - Intronic
1006268942 6:32949325-32949347 GGCCTTTGGCCTGGGTGTGCTGG - Exonic
1007582993 6:42970251-42970273 TCCCATTGGTGTGGGTGGGTAGG - Intronic
1009732979 6:67634313-67634335 TTCATGTGGTTTGGGTCTGCAGG + Intergenic
1010667374 6:78646406-78646428 TTCCTGTGGTGTATGTGTCCAGG + Intergenic
1011616068 6:89199397-89199419 TCCTGTTGGTGTGGATGTGCAGG - Exonic
1013049741 6:106520814-106520836 TCCCATTAGTGTTGGTGTGCAGG - Exonic
1013373012 6:109486545-109486567 TTCCTATGGTATGGGTTTGTTGG - Intergenic
1014417997 6:121208093-121208115 TTTTTTTGGTGTGTGTGTGAGGG - Intronic
1016657475 6:146538504-146538526 TTCCTTTGGGGTAGGCCTGCTGG + Intergenic
1017704972 6:157113741-157113763 TCCCTTTTGTGTGTGTGTGTTGG + Intronic
1018001054 6:159579001-159579023 TAACTCTGCTGTGGGTGTGCTGG + Intergenic
1018022171 6:159771712-159771734 TTCTTGTAGTGTAGGTGTGCAGG - Intronic
1019075049 6:169380169-169380191 TTCATTGGGTGTGTGTGTGGGGG + Intergenic
1019934925 7:4247896-4247918 TTCCTCTGGTGTGGGGCTGGAGG - Intronic
1021442500 7:20692458-20692480 TTCTTGTAGTGTAGGTGTGCTGG - Intronic
1022063612 7:26827002-26827024 TTATTTTGGTGTTGGTGTCCTGG - Intronic
1022317553 7:29259724-29259746 TTCCATTGCTGTGTGTGTGGTGG - Intronic
1022754183 7:33267879-33267901 TTCTTTTAGTGTGGGCCTGCTGG + Intronic
1023196843 7:37650053-37650075 TTCCTTTGAGCTGGGTGTGATGG - Intergenic
1026832465 7:73618563-73618585 TTGCTTTGGGGTGGGGGTGGGGG + Intronic
1027049098 7:75010422-75010444 CTCCTGGGGTGTGTGTGTGCAGG + Intronic
1028389206 7:90295459-90295481 TTCCTTTGGTTTGGGGCTGAGGG + Intronic
1028428310 7:90716253-90716275 CTCCTTTGGTGTGGGTGTGAGGG - Intronic
1030153613 7:106429647-106429669 TTCAGTTGGGGTGGGTGTGTGGG + Intergenic
1030203283 7:106927555-106927577 TTTCTTTCGTGTGGTTGTGATGG - Intergenic
1032199266 7:129807980-129808002 TTGCTTTGGAGTGGATGTGCTGG - Intergenic
1033452331 7:141472999-141473021 TTCCCTGTGTGTGGGTGTGCTGG + Exonic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034854685 7:154531504-154531526 TTCTTTTTGTATGGGTCTGCTGG - Intronic
1037732244 8:21536425-21536447 TTCTTGTGGTGTGGGTCTGTTGG - Intergenic
1038361978 8:26888990-26889012 TTCCTTTAGTATAGGTTTGCTGG + Intergenic
1038624669 8:29179524-29179546 TTCCTTTAGTGGGAGTGGGCAGG + Intronic
1039118614 8:34120844-34120866 TCCCTTTTGTGTGGCTGTGATGG - Intergenic
1042206151 8:66331901-66331923 TTCCTCTGGAGTGGGGGTGCAGG - Intergenic
1043148514 8:76683404-76683426 TTTGTTTGGTGTGTGTGTGGGGG - Intronic
1043540441 8:81256150-81256172 TTTTTTTGGTGTGTGTGTGGGGG + Intergenic
1044262629 8:90145144-90145166 TTCTTTTGGTGTGGGATTGCTGG + Intergenic
1044494185 8:92857324-92857346 TTCCTTTGGTTTAGGGTTGCTGG + Intergenic
1045793603 8:106016376-106016398 TTCTTATAGTGTGGGTATGCTGG - Intergenic
1046003957 8:108457280-108457302 TTCTTTTTGAGTGGGTGTGTGGG + Intronic
1046430150 8:114113793-114113815 TTCCTTTTGTGTGGGGGAGTGGG - Intergenic
1047091565 8:121581031-121581053 TTCATTTTGTGTGTGTGTGTGGG - Intergenic
1047986494 8:130240142-130240164 TTCCTTTTGTGGGGGGGAGCGGG + Intronic
1048398506 8:134039306-134039328 TGCTTTTGGTGTGTTTGTGCAGG + Intergenic
1048405047 8:134110503-134110525 TGCCTTCTCTGTGGGTGTGCTGG + Intergenic
1049254504 8:141606488-141606510 TTCCTTTCCTGAGGGTGTCCAGG + Intergenic
1049968761 9:802704-802726 TCCCCTTGGTGTGAGTGAGCCGG + Intergenic
1050603269 9:7273912-7273934 ATCTTTTGATGTGGGTGTGGGGG + Intergenic
1051226539 9:14905318-14905340 TTCCTTTGGTGATGGTTCGCAGG + Intronic
1051322806 9:15927394-15927416 CTCCATAGCTGTGGGTGTGCTGG - Intronic
1051841442 9:21402616-21402638 TTCCGTTTGTGTGGGGGCGCAGG - Intergenic
1052206616 9:25848726-25848748 TACCTTTTGTGTGTGTGTGTGGG - Intergenic
1052631229 9:31042495-31042517 TTCCTTTGGTGTCGGCCTGTGGG - Intergenic
1052647516 9:31254795-31254817 TTCCTTTGGTGTGTGTGTGGAGG - Intergenic
1052662327 9:31449809-31449831 TGCCTGTGGTGTGTGTGTGTGGG - Intergenic
1053004024 9:34592552-34592574 ATCCCTTGGTGTGTGTGTGGGGG - Intergenic
1053345405 9:37374531-37374553 TGCCATTGGTCTGGGGGTGCAGG - Intergenic
1056236628 9:84600970-84600992 CTCCCTTGGTGAGGCTGTGCTGG + Intergenic
1056399413 9:86212215-86212237 TTCCTTTAGAGTGGGTAGGCTGG - Intergenic
1056549932 9:87643940-87643962 ATTCTCTGGTGTGGGTGTGTGGG - Intronic
1057223332 9:93269696-93269718 TTCCTGTGATGTAGGGGTGCAGG + Intronic
1057798329 9:98173827-98173849 AGCCTTTGGTCTGGGTGTGGTGG + Intronic
1059001000 9:110348822-110348844 TTTTTTTGGTGTGTGTGTGGGGG + Intergenic
1059004983 9:110392405-110392427 TTCATTTTGTGTGTGTGTGGTGG + Intronic
1059008457 9:110430116-110430138 TTTTTTTGGTGTGTGTGTGTGGG + Intronic
1059013050 9:110483847-110483869 TTCCTTTGGTGTTGGGGATCAGG - Intronic
1059588474 9:115631742-115631764 TTTCTTTGGGCTGGGTGTGGTGG + Intergenic
1060307543 9:122429110-122429132 TTCCTGTAGTGTGGGTCTGGTGG + Intergenic
1060385678 9:123225934-123225956 TACCTTGGGTGTGGGAGCGCTGG - Intronic
1060670234 9:125462268-125462290 CTCCTTTGTTGGGGGTGGGCTGG + Intronic
1061721902 9:132557119-132557141 ATCCTGGGGTGTGTGTGTGCAGG + Intronic
1062368516 9:136224044-136224066 TTCCTTCCGTGTGGTTCTGCAGG + Exonic
1186526972 X:10257752-10257774 TTCCTTTGGTGTGTGTGTGGGGG - Intergenic
1187740826 X:22353698-22353720 TTGATTTGGTGTGTGTGCGCGGG + Intergenic
1188571790 X:31595337-31595359 TTCTTTTTGTGTGGGGGAGCTGG + Intronic
1189089000 X:38058482-38058504 TTCCTTTAGTGTGGCTTTGCTGG + Intronic
1189554881 X:42132024-42132046 TTCATCTGTTGTGGGTGTGTAGG + Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1191080088 X:56501104-56501126 TTCCTGTGGTGTTCCTGTGCGGG - Intergenic
1194947640 X:100088230-100088252 TTTTTTTGGTGTGAGTCTGCTGG - Intergenic
1195081620 X:101376723-101376745 TTCCTCTGGTGGGGGGGTGGGGG + Intronic
1196339107 X:114575584-114575606 TTTCTTTTGTGTGTGTGTGGGGG - Intergenic
1197147863 X:123188797-123188819 TTTCTAGGGTGTAGGTGTGCAGG + Intronic
1197802719 X:130368393-130368415 TTTCTTTTGTGTGTGTGTGGGGG - Intronic
1198304283 X:135365418-135365440 TTCCCTTGGTATGTGTGTGTGGG - Intergenic
1198478447 X:137018145-137018167 ATCTTTTGGTGGGGGTGTGGTGG - Intergenic
1199001803 X:142647743-142647765 TGCCTTTGGTGTAGGTGTTCTGG + Intergenic
1199930673 X:152516579-152516601 TTCATTTGGTTTGGGTTTGTAGG - Intergenic
1200325467 X:155233715-155233737 TACCTTTGCGGTGGGGGTGCTGG + Intronic
1200860096 Y:7982252-7982274 CTCCTTTTGTGTGTGTGTGGGGG - Intergenic
1200860400 Y:7985324-7985346 ATTCTTTGGTTTGGGTGTGGTGG - Intergenic
1201424830 Y:13836929-13836951 TTCTTTTGGTGTTGCTGTACTGG + Intergenic
1201537762 Y:15069297-15069319 TTCCTTTGGTTTGGGTAGGGAGG - Intergenic
1202370085 Y:24190233-24190255 TTCCTTTGGTGAGTGTTTGGAGG - Intergenic
1202500699 Y:25479884-25479906 TTCCTTTGGTGAGTGTTTGGAGG + Intergenic