ID: 1177020418

View in Genome Browser
Species Human (GRCh38)
Location 21:15849001-15849023
Sequence GCTTAAGTATTTGTACTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177020418 Original CRISPR GCTTAAGTATTTGTACTTAA TGG Intronic
905253865 1:36667296-36667318 GCTTAATTATTAGCAGTTAAGGG - Intergenic
908729411 1:67210402-67210424 TCTTAATTATTTGGACTAAATGG - Intronic
910340745 1:86184170-86184192 GCTGAAAGATTTGGACTTAATGG + Intergenic
911427897 1:97744132-97744154 ACTTAAGTACTGTTACTTAAAGG + Intronic
911657939 1:100465929-100465951 TTTTAAGCATTTGTAATTAAAGG - Intronic
912185659 1:107272846-107272868 GCTTAAGCATTTGTACTTAATGG - Intronic
920124232 1:203680930-203680952 GGTTAAGGAGTTCTACTTAAGGG + Intronic
921901467 1:220455905-220455927 GCTTAAGTACGTGTACTAAGAGG - Intergenic
922643834 1:227264725-227264747 GATTAAGAATATGTACATAATGG - Intronic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1067196213 10:44121437-44121459 GCATATTTATTTGTACTTCATGG + Intergenic
1068361438 10:55978571-55978593 GCTTAAATATTTGTCTTTTATGG + Intergenic
1068807190 10:61210674-61210696 TCTAAACTATTTGCACTTAATGG - Intergenic
1070431869 10:76348407-76348429 GCTTAAGCACTTTTACTTTATGG - Intronic
1071158119 10:82714951-82714973 GATTAAGCATTTGTAGTAAAAGG - Intronic
1072557089 10:96527343-96527365 CCTTAAATATTAGTATTTAAAGG + Intronic
1072707820 10:97694662-97694684 ACTGAAGTATTTGGAGTTAAAGG + Intergenic
1073817378 10:107222971-107222993 CCTTAAGCATTTGAACTGAAAGG - Intergenic
1073945836 10:108749203-108749225 GGTTAGGTATTTATACTAAATGG + Intergenic
1074707310 10:116145946-116145968 GTAGAAGTATTTGTACTGAATGG + Intronic
1075801364 10:125156042-125156064 AAAGAAGTATTTGTACTTAATGG - Intronic
1075859040 10:125657908-125657930 TATTAAATATTTGTACTTGAGGG + Intronic
1079755995 11:24263234-24263256 CCTTATGTATATGTACTTATAGG - Intergenic
1081513241 11:43798012-43798034 GTTTTATTATTTGTACCTAAGGG + Intronic
1082218723 11:49606125-49606147 GTTTAAGTAATTTTATTTAAAGG + Intergenic
1082797748 11:57390229-57390251 GCTTATTTGTTTGTACTTAATGG + Intronic
1083230892 11:61318038-61318060 GCTTAATTTTTTTTACTTTAAGG + Intronic
1086630850 11:89017997-89018019 GTTTAAGTAATTTTATTTAAAGG - Intronic
1094150964 12:27282487-27282509 GCTTAAGTAGTTGCAATCAAAGG + Intronic
1095549118 12:43412316-43412338 GCTTGAGCATTTTTATTTAAAGG + Intronic
1099333043 12:81315795-81315817 GCTTAAATATTTATCTTTAAAGG - Intronic
1100657040 12:96658447-96658469 GCTTTAGTATTTCCACTTACTGG + Intronic
1101680815 12:106963182-106963204 GGTTAAGTATTTGGCCTCAAAGG + Intronic
1103373308 12:120435954-120435976 GCCTAAGTTTTTATACTTCAGGG - Intergenic
1107620351 13:42222334-42222356 GCTAATGTATTTGTAGATAAAGG - Intronic
1109351215 13:61184121-61184143 TTTTAAGTATGTGTACCTAAAGG - Intergenic
1110508101 13:76313713-76313735 GCTTAAGTATGTGTAGTTTAGGG - Intergenic
1114576489 14:23719156-23719178 GTTTAAGTATTTGTGCACAAGGG + Intergenic
1116978257 14:51140116-51140138 GCTTAGGAATTTGTAATTCATGG + Intergenic
1120303763 14:82741059-82741081 GGTTAAGTATATGTGCTTTAGGG - Intergenic
1123909427 15:24952323-24952345 ACTTAAGGTTATGTACTTAAAGG - Intronic
1125459911 15:39895998-39896020 ACTTAAATTTTTGTAATTAAAGG + Intronic
1125961877 15:43837106-43837128 GCTTTAGGATTTGAACTCAAGGG + Intronic
1126174864 15:45726614-45726636 GCTGAAGTATTTGTAGGCAAAGG - Intergenic
1126249633 15:46552572-46552594 GCTTATGTATTTTTAATCAAAGG - Intergenic
1127142422 15:55991702-55991724 GCTGAAGGATTTGTACTTCTAGG - Intronic
1127372685 15:58355659-58355681 ACTTAAGTGTTTTTACTCAATGG - Intronic
1127750298 15:62032344-62032366 GCTTAAGTATCTGTATTTCTAGG - Intronic
1127829538 15:62738166-62738188 GCAGAAATGTTTGTACTTAAAGG + Intronic
1128626306 15:69208852-69208874 GCTCAAGTATTTGTTTTTTATGG + Intronic
1130696126 15:86133351-86133373 GCTTAAGTGTTACTTCTTAAGGG + Intergenic
1131040325 15:89258935-89258957 ACTTAAGTAATTTTACTGAAGGG + Intronic
1133185669 16:4096088-4096110 TCTTACGTATTTATATTTAAAGG + Intronic
1134911877 16:18034831-18034853 GCTTAACTCTTTCTAGTTAAGGG - Intergenic
1135047303 16:19166477-19166499 GGTTAACTATTTTTACTTATGGG + Intronic
1135286454 16:21197647-21197669 TCTTAAGTATTTTTAAATAAGGG + Intronic
1135465248 16:22679448-22679470 CCTTAGGTATTTGTCCTCAAAGG + Intergenic
1140645542 16:77025870-77025892 GCTGAAGTATTTGAAAGTAATGG - Intergenic
1141060196 16:80859875-80859897 GATTGAGTAATTGTACTGAAGGG - Intergenic
1142091421 16:88213440-88213462 TCTTACATATTTGCACTTAATGG + Intergenic
1143239338 17:5430646-5430668 GCTTATGTCTTTGTCCTTGAGGG + Intronic
1149045035 17:52235453-52235475 GCTTTATTATTAGTATTTAATGG + Intergenic
1149798227 17:59541200-59541222 GCTTTAATATTTGTACTTTTTGG + Intergenic
1150234403 17:63581305-63581327 TCTTAAGTATTTGAACTGCAGGG + Intronic
1150985387 17:70190913-70190935 ACTTAAGTATTTGGAATTTAGGG - Intergenic
1152973000 18:183725-183747 TCTGAAGTATTTTTATTTAAAGG + Intronic
1156808657 18:41220736-41220758 GCTTTATTATTTGTAATAAAGGG - Intergenic
1158816922 18:61111450-61111472 TCTTAAGTATTTGTAGATCAGGG - Intergenic
1165505585 19:36226617-36226639 GCTGAAGTATTTATAGATAAAGG - Intronic
926453616 2:13037803-13037825 TCTTATGTATTTTTGCTTAATGG + Intergenic
928035026 2:27814832-27814854 ACTTCTGTATTTGTTCTTAAAGG + Intronic
929110090 2:38398964-38398986 GCTAAAGGATTTGTACTCAATGG - Intergenic
931778393 2:65559263-65559285 GCTTAAATGCTTGTACTCAAAGG - Intergenic
933215796 2:79628678-79628700 GTTAAAGTATTTTTCCTTAATGG + Intronic
942306238 2:174610200-174610222 GCATACGTATTTGGAGTTAAAGG - Intronic
942440657 2:176032161-176032183 GCTTAAGAAAATGTACTTAGGGG - Intergenic
945335979 2:208592872-208592894 GCCTCAGTTTTTGTTCTTAAGGG + Intronic
1170034977 20:11980631-11980653 GCTTCTGTTTTTGTCCTTAAAGG + Intergenic
1175555512 20:59852480-59852502 GCTTTAGTTTTTCTATTTAAAGG - Intergenic
1177020418 21:15849001-15849023 GCTTAAGTATTTGTACTTAATGG + Intronic
1177461476 21:21416692-21416714 ATTTAAATATTTTTACTTAATGG + Intronic
1178159028 21:29889251-29889273 TGTTAAGTATTTTTTCTTAAAGG + Intronic
1179035449 21:37755614-37755636 ATTTAAGTATTTGTAATTGAGGG + Intronic
1182660630 22:31922574-31922596 GCGTAAGTATTATTACTTGAAGG - Intergenic
951154402 3:19331998-19332020 TTTTAAGTATTAGTACTTTAAGG + Intronic
951546074 3:23826741-23826763 GCTGAAATATTTGTTCTGAAGGG + Intronic
956077819 3:65524926-65524948 GCTTGAGTATTTGATCTAAAGGG - Intronic
963101310 3:141607808-141607830 ACTTAAGTATTTGTATTTCGAGG + Intronic
964907120 3:161730675-161730697 GCTTAAGTATTTGAGTTTAAAGG + Intergenic
965340161 3:167480823-167480845 GATAAAGCATTTGTACTTCATGG - Intronic
966324041 3:178734421-178734443 GCTGAAGTTCTTGCACTTAATGG - Intronic
970522915 4:16903532-16903554 GGGTAAGTATTTCCACTTAAAGG - Intergenic
971468062 4:26986989-26987011 GCTTAACTATTTCTACAAAATGG - Intronic
971518721 4:27521662-27521684 GATAATATATTTGTACTTAAAGG + Intergenic
975733548 4:77360012-77360034 GCTTAAGTTTATATGCTTAATGG + Intronic
977114011 4:92998015-92998037 TCCAAAGTATTTGAACTTAAGGG - Intronic
977755034 4:100659290-100659312 GATTAGGCATTTGTAATTAAGGG - Intronic
977769678 4:100843058-100843080 GCTTAAGTGTTTGTCCATAAAGG + Intronic
979317765 4:119285263-119285285 GCTGAAGTGTTTATACCTAATGG + Intronic
979627589 4:122863060-122863082 GTTTAAAAATTTGTACTTTAGGG + Intronic
980785358 4:137547207-137547229 GTTTAAATATTAGCACTTAACGG + Intergenic
981125570 4:141102416-141102438 TCTTGAGTATTTGTGCTGAAAGG - Intronic
982128229 4:152202998-152203020 GCTTGAGTGGCTGTACTTAATGG - Intergenic
982766469 4:159354692-159354714 GCTTCATAATTTCTACTTAATGG + Intronic
982972529 4:162008073-162008095 GATAAAGTATTTGTTTTTAAAGG + Intronic
984091874 4:175385591-175385613 GCTTATGGTTTTATACTTAAGGG - Intergenic
984167808 4:176323090-176323112 GCTTAAGTTTTGGTAATTATTGG + Intronic
985251069 4:188024979-188025001 GTATAAGTATTCATACTTAATGG - Intergenic
986529949 5:8726197-8726219 GGTTAAGTATTTTTAGTAAATGG - Intergenic
986780006 5:11056619-11056641 GCTTAAGTATTTTAAATTCATGG + Intronic
987017937 5:13839016-13839038 GCTTGAGTATCTGTTCTTACTGG - Intronic
987867974 5:23571368-23571390 CCTAAAGTTTTTGTAATTAAAGG - Intergenic
989507435 5:42243557-42243579 GATTAGGTATTTGGTCTTAAGGG - Intergenic
990388327 5:55291029-55291051 TCATAAGTATGTGTATTTAAAGG + Intronic
991083845 5:62630289-62630311 GCTAAAGTATTTGGAGATAAAGG - Intergenic
993072045 5:83177328-83177350 CCTTAATTTTTAGTACTTAACGG + Intronic
993681940 5:90889478-90889500 GTTTAAGAATATATACTTAAGGG - Intronic
993829373 5:92735417-92735439 TCCTAAGTATTTTTTCTTAAAGG + Intergenic
994109959 5:95990936-95990958 GTGAAAATATTTGTACTTAAGGG + Intergenic
994906354 5:105844950-105844972 GCTAAAGTATTTTTTCTTATAGG + Intergenic
994935555 5:106248698-106248720 GCTTATTTATTTGTAAATAAAGG - Intergenic
996741556 5:126803710-126803732 GCTTAAGTTTTTGTATTTTTTGG + Intronic
997164573 5:131646053-131646075 TCTTAAATATTTTTACATAAAGG + Intronic
999036179 5:148353101-148353123 TTTTAAGTAATTGCACTTAAAGG + Intergenic
999404314 5:151293649-151293671 AGTTAAATATTTGTGCTTAAAGG - Intronic
1008034251 6:46729646-46729668 GCTTAAGAATTCCTACTTTAGGG - Intronic
1008684349 6:53908028-53908050 GCTTAAGTATATATACTTCTGGG + Intronic
1009764946 6:68060424-68060446 GGTTAAGGCTTTGTATTTAAAGG - Intergenic
1011106344 6:83785918-83785940 TTTGAAGTATTAGTACTTAAAGG + Intergenic
1014666555 6:124244679-124244701 GCTTAAGTTTTTGTGTTTGAGGG - Intronic
1014865043 6:126519251-126519273 GGTTCATTATTTTTACTTAAGGG + Intergenic
1015103685 6:129511007-129511029 GCTTCAGCTTTTGCACTTAATGG + Intronic
1016362155 6:143278947-143278969 TCTTAAATAAATGTACTTAAAGG - Intronic
1016929093 6:149384587-149384609 ACTTCTGTATTTGTTCTTAATGG - Intronic
1017422776 6:154290152-154290174 GCCCAAGTATGTGTACTAAAGGG + Intronic
1019182780 6:170201839-170201861 TCTTAAGCATTTTTACATAAGGG - Intergenic
1023052188 7:36262754-36262776 GCTCAAGCATGTGTACTTAGAGG - Intronic
1023336021 7:39171373-39171395 GTTTTAGTAGTTATACTTAAAGG + Intronic
1023390596 7:39707791-39707813 TGTTAAATATTTGTCCTTAAAGG + Exonic
1024146268 7:46520234-46520256 GCTTCTTTATTTGTAATTAATGG + Intergenic
1026202315 7:68225019-68225041 GTTTAAATATTTATAATTAAAGG + Intergenic
1029972761 7:104805266-104805288 CCCTAAGTAGTTGAACTTAAGGG - Intronic
1031019450 7:116611527-116611549 GCAGAAGTATTTTTACTCAATGG + Intergenic
1038120625 8:24610465-24610487 ACTTAAGCATTTGTAGATAATGG - Intergenic
1040690515 8:49932021-49932043 GCTTAATTTTTTATAATTAAAGG + Intronic
1040776522 8:51049872-51049894 AGTTAAATATTTGTACTTACTGG - Intergenic
1044830080 8:96238663-96238685 GCTTAAGGATTTGCACATCAGGG - Intergenic
1045105286 8:98886736-98886758 GCTTAAGTCCTTATACATAATGG + Intronic
1045110708 8:98937496-98937518 GTTAAAGTATTTGTATTTAATGG - Intronic
1046191328 8:110798736-110798758 GCTTATGCATTTGTAGATAAGGG - Intergenic
1046697892 8:117362490-117362512 GCTTATGTATTTGTCCAGAAAGG + Intergenic
1051981034 9:23017130-23017152 GCTTTGGTATGTATACTTAAAGG + Intergenic
1053167916 9:35857598-35857620 ACTGAAGAATTTGGACTTAATGG + Intergenic
1055928512 9:81535831-81535853 GCTTAAGAATTTGTATTAGAAGG + Intergenic
1058185244 9:101847054-101847076 GCTTATGTATGTGTAGATAATGG - Intergenic
1058468113 9:105248900-105248922 CCGTAAGTCTTTGTCCTTAATGG + Intronic
1060082419 9:120662632-120662654 GCTTAAGTATTGGGACTGAGTGG - Intronic
1060670445 9:125464592-125464614 GTTTAAGGACTTGAACTTAATGG - Intronic
1061650215 9:132041711-132041733 GCTGAAAAATTTGTTCTTAAGGG + Intronic
1188061245 X:25604620-25604642 GCTTAAGTGTTTGTATTTGGTGG + Intergenic
1190099946 X:47514945-47514967 GATTAAGTGTTTGTAATTAAGGG - Intergenic
1192193919 X:69016128-69016150 GCTTAAATATATATATTTAAAGG - Intergenic
1194204678 X:90997361-90997383 GTTTATTTATTTGTTCTTAATGG - Intergenic
1196491499 X:116272734-116272756 CCTGAAGTATCTGTACTTTAGGG + Intergenic
1197593808 X:128442663-128442685 GCATAAGAATTTCTACTTCAGGG + Intergenic
1198403947 X:136294075-136294097 GCTAAAGTATTTGGAATGAAGGG + Intergenic
1200550522 Y:4572821-4572843 GTTTATTTATTTGTTCTTAATGG - Intergenic