ID: 1177020849

View in Genome Browser
Species Human (GRCh38)
Location 21:15855743-15855765
Sequence GGCCTAGTTGGTGGTCACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177020849_1177020854 -8 Left 1177020849 21:15855743-15855765 CCCATGTGACCACCAACTAGGCC 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1177020854 21:15855758-15855780 ACTAGGCCAAGAGGTAGAACAGG 0: 1
1: 0
2: 1
3: 3
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177020849 Original CRISPR GGCCTAGTTGGTGGTCACAT GGG (reversed) Intronic
903386073 1:22927680-22927702 GACCTAGTTGGTGGTTGCACAGG + Intergenic
908217930 1:61974223-61974245 ATCCTAATTGGTGGTCACATAGG - Intronic
908256468 1:62307891-62307913 GGCCTAGCTGGCAGGCACATGGG - Intronic
910247350 1:85153875-85153897 GGTCTAGGTGGTGGTTTCATAGG - Intergenic
911721306 1:101194160-101194182 GGACTACATGGTGGTCACACAGG + Intergenic
913444975 1:118941466-118941488 GGAATAGTTGGTGGTCTCCTGGG - Intronic
914377050 1:147080685-147080707 GGCCTAGGAGCTGGCCACATGGG + Intergenic
919490369 1:198198271-198198293 CACCTAGTGTGTGGTCACATGGG - Intronic
923357167 1:233169727-233169749 GAACTAGTTGGTGGTTACAGAGG - Intronic
923953411 1:238987542-238987564 GGCATAGTAGGTGGTCCCTTTGG + Intergenic
1063226319 10:4018077-4018099 CGCCTGTTTGCTGGTCACATGGG + Intergenic
1065789201 10:29244235-29244257 GGCCAGGCTGGTGGACACATTGG + Intergenic
1069184715 10:65408998-65409020 GGCCAATTTGTTGGTCCCATTGG - Intergenic
1069916782 10:71791372-71791394 GGGCCGGTTGGTGGTCACAGGGG + Intronic
1070856292 10:79610455-79610477 AGCTGAGTTGGTGGGCACATGGG - Intergenic
1072691985 10:97578072-97578094 GGCCTAGATGGCTCTCACATTGG - Intronic
1074170869 10:110935444-110935466 GTCCTAGTTGGTGGACATTTAGG + Intronic
1076314987 10:129533657-129533679 GGCCTGGATGGTGGTCACACTGG + Intronic
1077958428 11:7047024-7047046 GGCATAGTAGCTGTTCACATGGG + Intronic
1079549487 11:21676097-21676119 GGCCTTGTTGGTGTACTCATGGG - Intergenic
1080730410 11:34945804-34945826 GATCTAGGTGGTGGTAACATGGG - Intronic
1085194621 11:74661596-74661618 GTCCTAGTGGGTGGCCACAGGGG - Intronic
1087157194 11:94916956-94916978 AGCCTACTTGGCTGTCACATTGG - Intergenic
1097510245 12:60529861-60529883 GCCCCAGTGGGTGGTCTCATGGG - Intergenic
1099636209 12:85215723-85215745 TGCATTGTTGGTGGCCACATCGG - Intronic
1101701764 12:107180425-107180447 GACCTAGGTGGTGGCTACATGGG - Intergenic
1102490135 12:113285696-113285718 GGCCTAGATGGTGGCCAACTGGG - Intronic
1102897425 12:116609866-116609888 GGCATTTTTGGTTGTCACATTGG - Intergenic
1106012992 13:25843137-25843159 GGAGTAGGGGGTGGTCACATGGG + Intronic
1106906015 13:34409386-34409408 GGCCTAGGAAATGGTCACATAGG + Intergenic
1107126886 13:36856027-36856049 GGCCTAGGTGGTGGTGCCAGGGG + Intronic
1117688632 14:58281789-58281811 GGCCTAGATCTTGGTCAGATGGG - Intronic
1121451481 14:94011089-94011111 GGGGTAGTTGGTGGTTACAGTGG - Intergenic
1124961607 15:34401165-34401187 GACCAGGTTGGTGGTTACATGGG - Intronic
1124978233 15:34547387-34547409 GACCAGGTTGGTGGTTACATGGG - Intronic
1127151383 15:56079172-56079194 CACCTAGATGGTGGTCACAAGGG - Intergenic
1130266454 15:82409067-82409089 GACCAGGTTGGTGGTTACATGGG + Intergenic
1130505570 15:84537815-84537837 GACCAGGTTGGTGGTTACATGGG - Intergenic
1132257951 15:100394080-100394102 GACCTGGGTGGTGGTTACATGGG - Intergenic
1132596069 16:750793-750815 GTCATAGTTGGTGGTCAGCTTGG + Intronic
1133941947 16:10316748-10316770 CACCTAGATGGTGGTCCCATGGG + Intergenic
1138970729 16:62140058-62140080 AGCCTAATTGGTTTTCACATTGG + Intergenic
1143370843 17:6438127-6438149 GACCTAGGTGATGGTTACATGGG + Intergenic
1144807868 17:17979475-17979497 GGCCGAGGTGGTGGCCACAGGGG + Intronic
1155307584 18:24493733-24493755 AACCTGGTTGGTGGTCATATAGG - Intergenic
1157182892 18:45513031-45513053 GCCATTGTTGGTGGTGACATAGG - Intronic
1160573096 18:79831853-79831875 GGCCTAGGTGGTTGTCTCCTGGG + Intergenic
1167746077 19:51352557-51352579 GGCCGAGGTGATGGTCACATGGG - Intronic
1168250411 19:55138247-55138269 GGACTTGTAGGTGGTCACACGGG - Intronic
925254032 2:2466906-2466928 GGCCTAAATGGTGGTCACCTGGG - Intergenic
928318849 2:30267326-30267348 GGCCTAGTGGGAGGTCACAGGGG - Intronic
930173291 2:48274216-48274238 GGCTTGGTTGGTGGTTACAAAGG - Intergenic
933989975 2:87627134-87627156 GGACCACTTGGTGATCACATGGG + Intergenic
935879716 2:107551719-107551741 GGTCTAATTGGTGGTGACATTGG + Intergenic
936303870 2:111323690-111323712 GGACCACTTGGTGATCACATGGG - Intergenic
940797982 2:158100778-158100800 CGTCTAGTTGGTGGTAACAGTGG + Intronic
945884035 2:215355739-215355761 GACCTGGTTGGTGGTGACACAGG - Intergenic
946611873 2:221467249-221467271 GGCCTGGGTGACGGTCACATAGG + Intronic
948175190 2:235937738-235937760 GGCATTTTTGGTTGTCACATAGG + Intronic
948769880 2:240246247-240246269 GGCCTAGAGGGTGGCCAAATGGG - Intergenic
1168790768 20:574433-574455 GGCCTAGAAGGTGGGCAGATGGG + Intergenic
1172799681 20:37567071-37567093 GGCCAAGTGGGTGTTCACACTGG - Intergenic
1173704361 20:45099020-45099042 CACCTAGTGGGTGCTCACATAGG + Intronic
1175997503 20:62818155-62818177 TGCCCTGGTGGTGGTCACATGGG - Intronic
1177020849 21:15855743-15855765 GGCCTAGTTGGTGGTCACATGGG - Intronic
1178721618 21:35015645-35015667 GGCATACTTAGTGATCACATAGG + Intronic
1179912198 21:44456233-44456255 GGCCCAGTGGGTGGTCACTGCGG - Intronic
1180600266 22:17010773-17010795 GAACTACTTGGGGGTCACATAGG + Intergenic
1184367058 22:44058423-44058445 GGCCCAGCTGGTGTCCACATGGG - Intronic
955615389 3:60801511-60801533 GGGCTAGTTGGCCTTCACATTGG + Intronic
961407070 3:126687153-126687175 GGCCTAGTGGGTGGTCATGGGGG - Intergenic
963563961 3:146904068-146904090 AGCCGAGTTAGTGGTAACATTGG - Intergenic
965796691 3:172447942-172447964 GGCCAAGGTGGTGGTCACCAAGG - Exonic
968643279 4:1725762-1725784 GGCCCAGGTGGTGGTCACTGTGG + Intronic
969657863 4:8508451-8508473 GGCCTGGCTGGGGGTCACTTGGG - Intergenic
970260627 4:14220692-14220714 GACCTAGTTGGGGGTCAAAGAGG + Intergenic
970564921 4:17322698-17322720 GTCCAAGGTGGTAGTCACATGGG - Intergenic
975547054 4:75570556-75570578 GGTCTGGGTGGTGGTCACAGGGG + Intergenic
977158533 4:93605172-93605194 GGGCTAGTGGGTTATCACATTGG - Intronic
985900159 5:2782521-2782543 GACCTAGTCCGTGGTCACAGAGG + Intergenic
989406074 5:41062409-41062431 GACCTAAGTGGTGGCCACATGGG + Intronic
995328281 5:110917173-110917195 GGCATATTTAGTGGTCAGATAGG + Intergenic
997415198 5:133722919-133722941 GGCCATGATGGTGGCCACATAGG + Intergenic
997725074 5:136113626-136113648 GGCGAAGTTGGTGGTCACCTTGG + Intergenic
999888571 5:155951558-155951580 TGCCTAATTATTGGTCACATAGG + Intronic
1001006208 5:168052656-168052678 GGCCAACTTGGTGTACACATTGG - Intronic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1006416624 6:33908148-33908170 GACCTAGATGTTAGTCACATGGG + Intergenic
1011926899 6:92656470-92656492 GGCCTGGATGGTGTTTACATGGG + Intergenic
1013386032 6:109632091-109632113 GACCTGGTTGGTGGTTACATGGG + Intronic
1021847730 7:24779007-24779029 GGCTTAGGTGGAGGTCACATGGG - Intergenic
1022317077 7:29255356-29255378 GGACTGGCTGGGGGTCACATGGG - Intronic
1026512184 7:71036758-71036780 GACCTCGGTGGTGGTCACACAGG - Intergenic
1039410525 8:37351502-37351524 GTCCTAGTTTGTGCTCCCATAGG + Intergenic
1062153006 9:135031457-135031479 GGGCTAGATGGTGGTCAGATGGG + Intergenic
1186874899 X:13807271-13807293 GGCCCAGTTCTTGGCCACATGGG + Intronic
1188670143 X:32872057-32872079 GTCATCGTTGGTGGTGACATGGG + Intronic
1192221757 X:69202141-69202163 GACCTAGGTGGTGGTTACAGAGG - Intergenic
1195009487 X:100721664-100721686 GGGCTAGTTGGGGGGCTCATTGG - Intronic