ID: 1177024768

View in Genome Browser
Species Human (GRCh38)
Location 21:15908250-15908272
Sequence ATCACTAATCTTGCCAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177024761_1177024768 2 Left 1177024761 21:15908225-15908247 CCTGAGCCGCCTTGCCCGGCCCA No data
Right 1177024768 21:15908250-15908272 ATCACTAATCTTGCCAAATAAGG No data
1177024758_1177024768 24 Left 1177024758 21:15908203-15908225 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1177024768 21:15908250-15908272 ATCACTAATCTTGCCAAATAAGG No data
1177024762_1177024768 -4 Left 1177024762 21:15908231-15908253 CCGCCTTGCCCGGCCCAGCATCA No data
Right 1177024768 21:15908250-15908272 ATCACTAATCTTGCCAAATAAGG No data
1177024763_1177024768 -7 Left 1177024763 21:15908234-15908256 CCTTGCCCGGCCCAGCATCACTA No data
Right 1177024768 21:15908250-15908272 ATCACTAATCTTGCCAAATAAGG No data
1177024756_1177024768 27 Left 1177024756 21:15908200-15908222 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1177024768 21:15908250-15908272 ATCACTAATCTTGCCAAATAAGG No data
1177024759_1177024768 23 Left 1177024759 21:15908204-15908226 CCAAAGTGCTGGGATTACAGGCC 0: 4832
1: 222861
2: 273207
3: 187102
4: 182881
Right 1177024768 21:15908250-15908272 ATCACTAATCTTGCCAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177024768 Original CRISPR ATCACTAATCTTGCCAAATA AGG Intergenic
No off target data available for this crispr