ID: 1177049412

View in Genome Browser
Species Human (GRCh38)
Location 21:16213433-16213455
Sequence TTGATTAAGCAAGAGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177049410_1177049412 14 Left 1177049410 21:16213396-16213418 CCTACTCGTTGATGGTATTGAGA No data
Right 1177049412 21:16213433-16213455 TTGATTAAGCAAGAGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177049412 Original CRISPR TTGATTAAGCAAGAGGAAAA AGG Intergenic
No off target data available for this crispr