ID: 1177057157

View in Genome Browser
Species Human (GRCh38)
Location 21:16320156-16320178
Sequence CTCAGGAAAGGAGTCTGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177057152_1177057157 22 Left 1177057152 21:16320111-16320133 CCAAGTGGAGATATTGAGTAGAA No data
Right 1177057157 21:16320156-16320178 CTCAGGAAAGGAGTCTGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177057157 Original CRISPR CTCAGGAAAGGAGTCTGGAT TGG Intergenic
No off target data available for this crispr